RchiOBHm_Chr1g0356291

YT521-B-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
48795810 .. 48797155
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58168

Sequence Viewer

Length: 234 bp
ATGGTAACAGATGCAGATTTGAAGATTTTGATTGAAAATTTGGACGAGAAGATCGGTCAGAATAAGAAATGGGACAATGTCATAGAGAAAGGAAATGATCTTCTATACTACAGTGCTAAGTGCTGCAAGCCTAAGGTTGGTCCTGTGAAATACTTGAGTATGACAATATTTGAGGACTGCTCTCCTGAGATGCTGAGAGACTTCTACATGGATAATGATTACAGAAAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

9.07

Weight (kDa)

5.01

Isoelectric Point (pI)

42.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 137
AgsI TTSAA 2 cut(s) 22, 35
Alw26I GTCTC 1 cut(s) 192
ApeKI GCWGC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 140
AvaII GGWCC 1 cut(s) 140
AxyI CCTNAGG 1 cut(s) 132
BbvI GCAGC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 109
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmsI GCATC 1 cut(s) 180
BplI GAGNNNNNCTC 2 cut(s) 164, 196
BpuEI CTTGAG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse21I CCTNAGG 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 2 cut(s) 177, 185
BseXI GCAGC 1 cut(s) 110
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 192
BsmFI GGGAC 1 cut(s) 86
Bsp143I GATC 2 cut(s) 51, 97
BspCNI CTCAG 2 cut(s) 178, 186
BssMI GATC 2 cut(s) 51, 97
Bst4CI ACNGT 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 128
BstDEI CTNAG 4 cut(s) 117, 132, 186, 194
BstKTI GATC 2 cut(s) 54, 100
BstMAI GTCTC 1 cut(s) 192
BstMBI GATC 2 cut(s) 51, 97
BstSFI CTRYAG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 110
Bsu36I CCTNAGG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 140
CviAII CATG 1 cut(s) 208
CviJI RGCY 1 cut(s) 130
CviKI_1 RGCY 1 cut(s) 130
DdeI CTNAG 4 cut(s) 117, 132, 186, 194
DpnI GATC 2 cut(s) 53, 99
DpnII GATC 2 cut(s) 51, 97
Eco47I GGWCC 1 cut(s) 140
Eco81I CCTNAGG 1 cut(s) 132
FaeI CATG 1 cut(s) 211
FaiI YATR 4 cut(s) 83, 106, 161, 209
FaqI GGGAC 1 cut(s) 86
FatI CATG 1 cut(s) 207
Fnu4HI GCNGC 1 cut(s) 124
Fsp4HI GCNGC 1 cut(s) 124
GluI GCNGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 14, 126
HpyF3I CTNAG 4 cut(s) 117, 132, 186, 194
Hsp92II CATG 1 cut(s) 211
Kzo9I GATC 2 cut(s) 51, 97
LpnPI CCDG 2 cut(s) 156, 198
Lsp1109I GCAGC 1 cut(s) 110
LweI GCATC 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 4
MalI GATC 2 cut(s) 53, 99
MboI GATC 2 cut(s) 51, 97
MboII GAAGA 3 cut(s) 34, 61, 92
MluCI AATT 1 cut(s) 37
MnlI CCTC 1 cut(s) 166
NdeII GATC 2 cut(s) 51, 97
NlaIII CATG 1 cut(s) 211
PflFI GACNNNGTC 1 cut(s) 77
PkrI GCNGC 1 cut(s) 125
PspPI GGNCC 1 cut(s) 140
PsyI GACNNNGTC 1 cut(s) 77
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 2 cut(s) 51, 97
Sau96I GGNCC 1 cut(s) 140
SetI ASST 1 cut(s) 138
SfaNI GCATC 1 cut(s) 180
SfcI CTRYAG 1 cut(s) 109
SgeI CNNG 6 cut(s) 58, 139, 155, 166, 197, 220
SinI GGWCC 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
Sse9I AATT 1 cut(s) 37
SspI AATATT 1 cut(s) 168
TaaI ACNGT 1 cut(s) 113
TaqII GACCGA 1 cut(s) 44
TasI AATT 1 cut(s) 37
TscAI CASTG 1 cut(s) 118
TseI GCWGC 1 cut(s) 123
TspRI CASTG 1 cut(s) 118
Tth111I GACNNNGTC 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 140
XapI RAATTY 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.