RchiOBHm_Chr1g0380771

O-acyltransferase (WSD1-like)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
66290082 .. 66290316
235 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60401

Sequence Viewer

Length: 207 bp
ATGGCTATTTGGTTAGCAGTAACATTGATAGGGAACACTCTTGTTGATCTTGTGCTATTTTTTGCCACAATTCTGGTTTTGAAAGACACCAAGACGCCTATTAAAGGTCCACCTGGGGTTGAGCTTACTGCCAAGCGGTTCTTCCATCGAACGGTTAGTTTGGATCACATCAAGCAAGTGAAGTCACACATACATATTTCCTTATAG

Protein Analysis

68

Amino Acids

7.6

Weight (kDa)

9.99

Isoelectric Point (pI)

33.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 136
AclWI GGATC 1 cut(s) 171
AcyI GRCGYC 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 104, 151
AgsI TTSAA 1 cut(s) 82
AjnI CCWGG 1 cut(s) 112
AjuI GAANNNNNNNTTGG 2 cut(s) 125, 157
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AlwI GGATC 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 107
BccI CCATC 1 cut(s) 153
BciT130I CCWGG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 114
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 2 cut(s) 104, 151
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 113
BseLI CCNNNNNNNGG 2 cut(s) 104, 151
BslI CCNNNNNNNGG 2 cut(s) 104, 151
Bsp143I GATC 2 cut(s) 46, 163
BspACI CCGC 1 cut(s) 136
BspPI GGATC 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 2 cut(s) 46, 163
BssNI GRCGYC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 154
BstACI GRCGYC 1 cut(s) 95
BstENI CCTNNNNNAGG 1 cut(s) 102
BstKTI GATC 2 cut(s) 49, 166
BstMBI GATC 2 cut(s) 46, 163
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstXI CCANNNNNNTGG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 107
CseI GACGC 1 cut(s) 103
CviJI RGCY 2 cut(s) 5, 124
CviKI_1 RGCY 2 cut(s) 5, 124
DpnI GATC 2 cut(s) 48, 165
DpnII GATC 2 cut(s) 46, 163
Eco47I GGWCC 1 cut(s) 107
EcoNI CCTNNNNNAGG 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 112
FaiI YATR 3 cut(s) 191, 195, 205
FalI AAGNNNNNCTT 2 cut(s) 125, 157
HgaI GACGC 1 cut(s) 103
Hin1I GRCGYC 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 154
Hsp92I GRCGYC 1 cut(s) 95
Kzo9I GATC 2 cut(s) 46, 163
LpnPI CCDG 3 cut(s) 59, 99, 126
MaeIII GTNAC 2 cut(s) 19, 183
MalI GATC 2 cut(s) 48, 165
MboI GATC 2 cut(s) 46, 163
MboII GAAGA 1 cut(s) 133
MluCI AATT 1 cut(s) 69
MseI TTAA 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 2 cut(s) 46, 163
NmuCI GTSAC 1 cut(s) 183
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspPI GGNCC 1 cut(s) 107
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 2 cut(s) 46, 163
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 114
SetI ASST 3 cut(s) 109, 115, 126
SgeI CNNG 9 cut(s) 53, 62, 86, 103, 125, 126, 145, 184, 188
SinI GGWCC 1 cut(s) 107
Sse9I AATT 1 cut(s) 69
SsiI CCGC 1 cut(s) 136
StyD4I CCNGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 69
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseFI GTSAC 1 cut(s) 183
Tsp45I GTSAC 1 cut(s) 183
VpaK11BI GGWCC 1 cut(s) 107
XagI CCTNNNNNAGG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.