Rmu_sc0005438.1_g000009

O-acyltransferase (WSD1-like)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005438.1
Physical Location & Seq
Reverse (-)
37509 .. 37808
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005438.1_g000009.1.cds

Sequence Viewer

Length: 300 bp
atgaagcatgctgaacagtttgttgaccagtacatttccaaccttaccacaagccctcttgacctttccaagccactatgggaagtccatatcctcaatgtcaaaacctctgatgcagaagctgttgcaccgattcggattcaccactcgatgggggatggggcatccctcatgtcacttctactagcttgtgctcgaaaaacatcagggtccctgatgcattgcctactgttccaaccaagaggaaacaggaggatagtccttcaagtgattcgggcgtgttctagtggctcttattga

Protein Analysis

99

Amino Acids

10.93

Weight (kDa)

8.99

Isoelectric Point (pI)

53.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 151
AfaI GTAC 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 266
AluBI AGCT 2 cut(s) 122, 188
AluI AGCT 2 cut(s) 122, 188
Alw21I GWGCWC 1 cut(s) 196
AlwNI CAGNNNCTG 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 134
AvaII GGWCC 1 cut(s) 210
Bbv12I GWGCWC 1 cut(s) 196
BccI CCATC 2 cut(s) 145, 152
BfaI CTAG 2 cut(s) 185, 285
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 1 cut(s) 210
BmiI GGNNCC 2 cut(s) 211, 212
BmsI GCATC 3 cut(s) 103, 173, 207
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse1I ACTGG 1 cut(s) 28
Bse3DI GCAATG 1 cut(s) 220
BseGI GGATG 2 cut(s) 163, 164
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMI GCAATG 1 cut(s) 220
BseNI ACTGG 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 196
BslFI GGGAC 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 151
BsmFI GGGAC 1 cut(s) 196
Bsp1286I GDGCHC 1 cut(s) 196
BspLI GGNNCC 2 cut(s) 211, 212
BsrDI GCAATG 1 cut(s) 220
BsrI ACTGG 1 cut(s) 28
Bst4CI ACNGT 2 cut(s) 18, 231
BstC8I GCNNGC 1 cut(s) 9
BstF5I GGATG 2 cut(s) 163, 164
BstNSI RCATGY 1 cut(s) 11
BtsCI GGATG 2 cut(s) 163, 164
Cac8I GCNNGC 1 cut(s) 9
CaiI CAGNNNCTG 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 210
Csp6I GTAC 1 cut(s) 31
CviAII CATG 2 cut(s) 8, 172
CviJI RGCY 5 cut(s) 54, 73, 122, 188, 291
CviKI_1 RGCY 5 cut(s) 54, 73, 122, 188, 291
CviQI GTAC 1 cut(s) 31
Eco47I GGWCC 1 cut(s) 210
EcoO109I RGGNCCY 1 cut(s) 210
EcoT22I ATGCAT 1 cut(s) 222
FaeI CATG 2 cut(s) 11, 175
FaiI YATR 4 cut(s) 9, 79, 90, 173
FaqI GGGAC 1 cut(s) 196
FatI CATG 2 cut(s) 7, 171
FokI GGATG 2 cut(s) 151, 170
FspBI CTAG 2 cut(s) 185, 285
Hin1II CATG 2 cut(s) 11, 175
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 3 cut(s) 133, 139, 271
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 112, 138
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 272
HpyCH4III ACNGT 2 cut(s) 18, 231
HpyCH4V TGCA 3 cut(s) 116, 128, 220
Hsp92II CATG 2 cut(s) 11, 175
KflI GGGWCCC 1 cut(s) 210
LpnPI CCDG 4 cut(s) 41, 192, 227, 235
LweI GCATC 3 cut(s) 103, 173, 207
MaeI CTAG 2 cut(s) 185, 285
MaeIII GTNAC 1 cut(s) 174
MhlI GDGCHC 1 cut(s) 196
MmeI TCCRAC 2 cut(s) 63, 259
MnlI CCTC 6 cut(s) 66, 104, 118, 179, 236, 246
Mph1103I ATGCAT 1 cut(s) 222
NlaIII CATG 2 cut(s) 11, 175
NlaIV GGNNCC 2 cut(s) 211, 212
NmuCI GTSAC 1 cut(s) 174
NsiI ATGCAT 1 cut(s) 222
NspI RCATGY 1 cut(s) 11
PaeI GCATGC 1 cut(s) 11
PfeI GAWTC 3 cut(s) 133, 139, 271
PflMI CCANNNNNTGG 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 210
Psp5II RGGWCCY 1 cut(s) 210
PspN4I GGNNCC 2 cut(s) 211, 212
PspPI GGNCC 1 cut(s) 210
PspPPI RGGWCCY 1 cut(s) 210
PstNI CAGNNNCTG 1 cut(s) 122
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
Sau96I GGNCC 1 cut(s) 210
SduI GDGCHC 1 cut(s) 196
SetI ASST 5 cut(s) 45, 66, 110, 124, 190
SfaNI GCATC 3 cut(s) 103, 173, 207
SinI GGWCC 1 cut(s) 210
SphI GCATGC 1 cut(s) 11
SspMI CTAG 2 cut(s) 185, 285
TaaI ACNGT 2 cut(s) 18, 231
TaqI TCGA 2 cut(s) 149, 196
TatI WGTACW 1 cut(s) 30
TfiI GAWTC 3 cut(s) 133, 139, 271
TseFI GTSAC 1 cut(s) 174
Tsp45I GTSAC 1 cut(s) 174
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 151
VpaK11BI GGWCC 1 cut(s) 210
XceI RCATGY 1 cut(s) 11
XspI CTAG 2 cut(s) 185, 285
Zsp2I ATGCAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.