RchiOBHm_Chr2g0105031

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002165
Physical Location & Seq
Reverse (-)
16346038 .. 16347231
1194 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47927

Sequence Viewer

Length: 957 bp
ATGTTTTCAACGTTTGGTTATCCTGCATCTGGCGATGCTATTAGCTATAGTCAGAACCCTATTCAAAGTCAAGTTGCTGCTCAAAGTGAACCCAAAACCACAAAGAAAGCTAAAAGAGCCAAGAATTTCTCCATTCAAGAAGACAACCTTCTTGTGTCTGCCTGGCTCAATACTACCCTTGATCCAGCAATAGGAAATGATCAAAAAGGTGCTGCTTATTGGAAAAGAATTTGGGACTATTTCTATGCTGAGAAGAACTTTGAACTAGAGTGTGATCGTAATCAGGGTTCTCTCATGCATCGCTGGTCTGGAATTCAACTGGATGTGAACAAATTTTGTGGCTATATTGCTGAAATTGAAAGGACAAGAGCAAGTGGTACAACTGAACAAGATAGGATTGTGGAAGCCAAACAAAAGTTTAGGAGGGAGCGAGGATACAACTTTACATATGAGCATTGTTGGCATGTGTTGAAGTTCCACCCGAAATGGAACTTGGAACTCTCTAGGAAAAAACCAAAGAAAACTCATGCAACGGTTCCTACTACTTCGTCTCCTATCACTCCATCTGCTAGCCCAGATACAATAGATTTAGCTGATGGCAATGTTGAAGGTAATGAGTCTCCATGCTTGGAGAGGCCTATAGGCAAAAAGGCTGCCAAGACCTTGGCAAGGAAGGCAAAAGCTAAAGAGAAAGTGGAAGCAGCCCAATCTGAATTAGGAGACTATTATGCTCTGAAAGTTGAACATGCTCATAAGGAGGATGAGCAATTTCAACTGATGTATGATGCAGAACAAGAGAACATTAAGCTGAGGAAACAAGAACTTGAAATTCAAGTTCGAAAAGAGGATAATGCAATAATGGCAATTGATACTTCTACAATGGAACCAATGCGGGCAGAATATTTTAGAGGACTTCAACAGGAAATCATAGCAAAAAGAGCTACTAATGGAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

318

Amino Acids

36.39

Weight (kDa)

8.46

Isoelectric Point (pI)

49.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 148 - 309 8e-24 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 892
AclI AACGTT 1 cut(s) 11
AclWI GGATC 1 cut(s) 176
AcsI RAATTY 5 cut(s) 124, 228, 312, 332, 828
AfaI GTAC 1 cut(s) 379
AfiI CCNNNNNNNGG 3 cut(s) 29, 191, 669
AjnI CCWGG 1 cut(s) 161
AjuI GAANNNNNNNTTGG 2 cut(s) 476, 508
AluBI AGCT 6 cut(s) 45, 110, 593, 683, 808, 941
AluI AGCT 6 cut(s) 45, 110, 593, 683, 808, 941
Alw26I GTCTC 3 cut(s) 555, 624, 714
AlwI GGATC 1 cut(s) 176
AoxI GGCC 1 cut(s) 635
ApeKI GCWGC 4 cut(s) 77, 212, 653, 701
ApoI RAATTY 5 cut(s) 124, 228, 312, 332, 828
AsuII TTCGAA 1 cut(s) 838
AsuNHI GCTAGC 1 cut(s) 569
BbsI GAAGAC 1 cut(s) 147
BbvCI CCTCAGC 1 cut(s) 809
BbvI GCAGC 4 cut(s) 64, 199, 640, 713
BccI CCATC 2 cut(s) 571, 590
BciT130I CCWGG 1 cut(s) 163
BciVI GTATCC 1 cut(s) 428
BclI TGATCA 1 cut(s) 199
BcoDI GTCTC 3 cut(s) 555, 624, 714
BfaI CTAG 4 cut(s) 266, 504, 570, 955
BfmI CTRYAG 2 cut(s) 46, 639
BfuI GTATCC 1 cut(s) 428
BisI GCNGC 4 cut(s) 78, 213, 654, 702
BlsI GCNGC 4 cut(s) 79, 214, 655, 703
Bme1390I CCNGG 1 cut(s) 163
BmiI GGNNCC 2 cut(s) 537, 885
BmrFI CCNGG 1 cut(s) 163
BmsI GCATC 4 cut(s) 25, 35, 307, 775
BmtI GCTAGC 1 cut(s) 573
BpiI GAAGAC 1 cut(s) 147
Bpu10I CCTNAGC 1 cut(s) 809
Bpu14I TTCGAA 1 cut(s) 838
BsaBI GATNNNNATC 1 cut(s) 279
BsaJI CCNNGG 1 cut(s) 663
BsaXI ACNNNNNCTCC 2 cut(s) 535, 565
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 191, 669
Bse1I ACTGG 1 cut(s) 324
Bse3DI GCAATG 1 cut(s) 607
Bse8I GATNNNNATC 1 cut(s) 279
BseBI CCWGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 663
BseGI GGATG 2 cut(s) 328, 766
BseJI GATNNNNATC 1 cut(s) 279
BseLI CCNNNNNNNGG 3 cut(s) 29, 191, 669
BseMI GCAATG 1 cut(s) 607
BseMII CTCAG 2 cut(s) 240, 800
BseNI ACTGG 1 cut(s) 324
BseXI GCAGC 4 cut(s) 64, 199, 640, 713
BshFI GGCC 1 cut(s) 637
BslFI GGGAC 1 cut(s) 248
BslI CCNNNNNNNGG 3 cut(s) 29, 191, 669
BsmAI GTCTC 3 cut(s) 555, 624, 714
BsmBI CGTCTC 1 cut(s) 555
BsmFI GGGAC 1 cut(s) 248
BsnI GGCC 1 cut(s) 637
Bsp119I TTCGAA 1 cut(s) 838
Bsp143I GATC 3 cut(s) 181, 199, 274
BspACI CCGC 1 cut(s) 892
BspANI GGCC 1 cut(s) 637
BspCNI CTCAG 2 cut(s) 241, 801
BspLI GGNNCC 2 cut(s) 537, 885
BspOI GCTAGC 1 cut(s) 573
BspPI GGATC 1 cut(s) 176
BspT104I TTCGAA 1 cut(s) 838
BsrDI GCAATG 1 cut(s) 607
BsrI ACTGG 1 cut(s) 324
BssECI CCNNGG 1 cut(s) 663
BssMI GATC 3 cut(s) 181, 199, 274
BssT1I CCWWGG 1 cut(s) 663
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 1 cut(s) 535
BstBI TTCGAA 1 cut(s) 838
BstC8I GCNNGC 2 cut(s) 571, 894
BstDEI CTNAG 2 cut(s) 249, 809
BstENI CCTNNNNNAGG 1 cut(s) 667
BstF5I GGATG 2 cut(s) 328, 766
BstKTI GATC 3 cut(s) 184, 202, 277
BstMAI GTCTC 3 cut(s) 555, 624, 714
BstMBI GATC 3 cut(s) 181, 199, 274
BstMWI GCNNNNNNNGC 5 cut(s) 116, 460, 674, 860, 938
BstNI CCWGG 1 cut(s) 163
BstNSI RCATGY 2 cut(s) 467, 749
BstSCI CCNGG 1 cut(s) 161
BstSFI CTRYAG 2 cut(s) 46, 639
BstV1I GCAGC 4 cut(s) 64, 199, 640, 713
BstV2I GAAGAC 1 cut(s) 147
BstXI CCANNNNNNTGG 1 cut(s) 664
BsuI GTATCC 1 cut(s) 428
BsuRI GGCC 1 cut(s) 637
BtgZI GCGATG 2 cut(s) 48, 284
BtsCI GGATG 2 cut(s) 328, 766
Cac8I GCNNGC 2 cut(s) 571, 894
Csp6I GTAC 1 cut(s) 378
CspCI CAANNNNNGTGG 2 cut(s) 319, 354
CviAII CATG 5 cut(s) 295, 464, 527, 624, 746
CviQI GTAC 1 cut(s) 378
DdeI CTNAG 2 cut(s) 249, 809
DpnI GATC 3 cut(s) 183, 201, 276
DpnII GATC 3 cut(s) 181, 199, 274
Eco130I CCWWGG 1 cut(s) 663
Eco147I AGGCCT 1 cut(s) 637
EcoNI CCTNNNNNAGG 1 cut(s) 667
EcoRI GAATTC 1 cut(s) 312
EcoRII CCWGG 1 cut(s) 161
EcoT14I CCWWGG 1 cut(s) 663
EcoT22I ATGCAT 1 cut(s) 300
ErhI CCWWGG 1 cut(s) 663
Esp3I CGTCTC 1 cut(s) 555
FaeI CATG 5 cut(s) 298, 467, 530, 627, 749
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FaqI GGGAC 1 cut(s) 248
FatI CATG 5 cut(s) 294, 463, 526, 623, 745
FauI CCCGC 1 cut(s) 885
FauNDI CATATG 1 cut(s) 448
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 4 cut(s) 78, 213, 654, 702
FokI GGATG 2 cut(s) 335, 773
Fsp4HI GCNGC 4 cut(s) 78, 213, 654, 702
FspBI CTAG 4 cut(s) 266, 504, 570, 955
GluI GCNGC 4 cut(s) 78, 213, 654, 702
HaeIII GGCC 1 cut(s) 637
Hin1II CATG 5 cut(s) 298, 467, 530, 627, 749
HinfI GANTC 1 cut(s) 617
Hpy166II GTNNAC 2 cut(s) 89, 328
Hpy188I TCNGA 3 cut(s) 54, 712, 735
Hpy188III TCNNGA 2 cut(s) 137, 309
Hpy8I GTNNAC 2 cut(s) 89, 328
HpyAV CCTTC 3 cut(s) 158, 602, 667
HpyCH4III ACNGT 1 cut(s) 535
HpyCH4IV ACGT 1 cut(s) 11
HpyCH4V TGCA 5 cut(s) 26, 298, 530, 788, 854
HpyF10VI GCNNNNNNNGC 5 cut(s) 116, 460, 674, 860, 938
HpyF3I CTNAG 2 cut(s) 249, 809
HpySE526I ACGT 1 cut(s) 11
Hsp92II CATG 5 cut(s) 298, 467, 530, 627, 749
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 3 cut(s) 181, 199, 274
LmnI GCTCC 1 cut(s) 427
Lsp1109I GCAGC 4 cut(s) 64, 199, 640, 713
LweI GCATC 4 cut(s) 25, 35, 307, 775
MaeI CTAG 4 cut(s) 266, 504, 570, 955
MaeII ACGT 1 cut(s) 11
MalI GATC 3 cut(s) 183, 201, 276
MboI GATC 3 cut(s) 181, 199, 274
MboII GAAGA 2 cut(s) 152, 265
MfeI CAATTG 1 cut(s) 864
MluCI AATT 9 cut(s) 124, 228, 312, 332, 354, 713, 767, 828, 864
MlyI GAGTC 1 cut(s) 626
MnlI CCTC 7 cut(s) 417, 425, 627, 751, 804, 838, 902
Mph1103I ATGCAT 1 cut(s) 300
MseI TTAA 1 cut(s) 804
MspR9I CCNGG 1 cut(s) 163
MunI CAATTG 1 cut(s) 864
MvaI CCWGG 1 cut(s) 163
MwoI GCNNNNNNNGC 5 cut(s) 116, 460, 674, 860, 938
NdeI CATATG 1 cut(s) 448
NdeII GATC 3 cut(s) 181, 199, 274
NheI GCTAGC 1 cut(s) 569
NlaIII CATG 5 cut(s) 298, 467, 530, 627, 749
NlaIV GGNNCC 2 cut(s) 537, 885
NsiI ATGCAT 1 cut(s) 300
NspI RCATGY 2 cut(s) 467, 749
NspV TTCGAA 1 cut(s) 838
PceI AGGCCT 1 cut(s) 637
PkrI GCNGC 4 cut(s) 79, 214, 655, 703
PleI GAGTC 1 cut(s) 625
PpsI GAGTC 1 cut(s) 625
Psp1406I AACGTT 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspN4I GGNNCC 2 cut(s) 537, 885
PsrI GAACNNNNNNTAC 2 cut(s) 271, 303
RsaI GTAC 1 cut(s) 379
RsaNI GTAC 1 cut(s) 378
SaqAI TTAA 1 cut(s) 804
SatI GCNGC 4 cut(s) 78, 213, 654, 702
Sau3AI GATC 3 cut(s) 181, 199, 274
SchI GAGTC 1 cut(s) 626
ScrFI CCNGG 1 cut(s) 163
SfaNI GCATC 4 cut(s) 25, 35, 307, 775
SfcI CTRYAG 2 cut(s) 46, 639
SfuI TTCGAA 1 cut(s) 838
Sse9I AATT 9 cut(s) 124, 228, 312, 332, 354, 713, 767, 828, 864
SseBI AGGCCT 1 cut(s) 637
SsiI CCGC 1 cut(s) 892
SspI AATATT 1 cut(s) 902
SspMI CTAG 4 cut(s) 266, 504, 570, 955
StuI AGGCCT 1 cut(s) 637
StyD4I CCNGG 1 cut(s) 161
StyI CCWWGG 1 cut(s) 663
TaaI ACNGT 1 cut(s) 535
TaiI ACGT 1 cut(s) 14
TaqI TCGA 1 cut(s) 838
TasI AATT 9 cut(s) 124, 228, 312, 332, 354, 713, 767, 828, 864
Tru1I TTAA 1 cut(s) 804
Tru9I TTAA 1 cut(s) 804
TseI GCWGC 4 cut(s) 77, 212, 653, 701
XagI CCTNNNNNAGG 1 cut(s) 667
XapI RAATTY 5 cut(s) 124, 228, 312, 332, 828
XceI RCATGY 2 cut(s) 467, 749
XspI CTAG 4 cut(s) 266, 504, 570, 955
Zsp2I ATGCAT 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.