Rh3BG134000

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
11336674 .. 11337828
1155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG134000.1

Sequence Viewer

Length: 384 bp
ATGGATTCTGCTCAAGTCTCCCCTGTTGCAATAGATTTAGGAGAGGATTTTTTGAATTATTCCAATATCCTCAATGAAAGCTCAGGGCGTAATGATAATGTGTTTTCAACATTTGGTTGTCCTACATCTGGTGATGCTATTAGCTATAGTCAAAGCTCTATTCAAAGTCAAGTTGGTGTTCAAAGTGAACCCAAAACCACAAAGAGAGCTAAAAAAGCCAAGAATTTCTCCATTCAAGAAGACAACCTTCTTGTGTCTGCCTGGCTCAATACTACCCTTGATCCAGCAATTGAAAATGATCAAAAAGGTGTTGCTTATTGGAAAAGAATTTGGGAGAATTTCTCTGCTGAGAAGAACTCTAAACTAGAGTGTGATCGTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.15

Weight (kDa)

4.78

Isoelectric Point (pI)

57.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 275
AcsI RAATTY 3 cut(s) 223, 327, 337
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 6 cut(s) 55, 108, 164, 182, 236, 293
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 4 cut(s) 81, 144, 156, 209
AluI AGCT 4 cut(s) 81, 144, 156, 209
Alw26I GTCTC 1 cut(s) 22
AlwI GGATC 1 cut(s) 275
ApoI RAATTY 3 cut(s) 223, 327, 337
AsuHPI GGTGA 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 246
BciT130I CCWGG 1 cut(s) 262
BclI TGATCA 1 cut(s) 298
BcoDI GTCTC 1 cut(s) 22
BfaI CTAG 1 cut(s) 365
BfmI CTRYAG 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 262
BmrFI CCNGG 1 cut(s) 262
BmsI GCATC 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 246
BplI GAGNNNNNCTC 4 cut(s) 326, 358, 341, 373
Bpu10I CCTNAGC 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseBI CCWGG 1 cut(s) 262
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMII CTCAG 2 cut(s) 96, 339
BslI CCNNNNNNNGG 1 cut(s) 128
BsmAI GTCTC 1 cut(s) 22
Bsp143I GATC 3 cut(s) 280, 298, 373
BspCNI CTCAG 2 cut(s) 95, 340
BspPI GGATC 1 cut(s) 275
BssMI GATC 3 cut(s) 280, 298, 373
Bst2UI CCWGG 1 cut(s) 262
BstDEI CTNAG 2 cut(s) 82, 348
BstKTI GATC 3 cut(s) 283, 301, 376
BstMAI GTCTC 1 cut(s) 22
BstMBI GATC 3 cut(s) 280, 298, 373
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 145
BstV2I GAAGAC 1 cut(s) 246
CviJI RGCY 6 cut(s) 81, 144, 156, 209, 218, 265
CviKI_1 RGCY 6 cut(s) 81, 144, 156, 209, 218, 265
DdeI CTNAG 2 cut(s) 82, 348
DpnI GATC 3 cut(s) 282, 300, 375
DpnII GATC 3 cut(s) 280, 298, 373
EcoRII CCWGG 1 cut(s) 260
FaiI YATR 1 cut(s) 147
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FbaI TGATCA 1 cut(s) 298
FspBI CTAG 1 cut(s) 365
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 188
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 188
HpyAV CCTTC 1 cut(s) 257
HpyCH4V TGCA 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 2 cut(s) 82, 348
Ksp22I TGATCA 1 cut(s) 298
Kzo9I GATC 3 cut(s) 280, 298, 373
LpnPI CCDG 6 cut(s) 36, 69, 114, 247, 274, 297
LweI GCATC 1 cut(s) 124
MaeI CTAG 1 cut(s) 365
MalI GATC 3 cut(s) 282, 300, 375
MboI GATC 3 cut(s) 280, 298, 373
MboII GAAGA 2 cut(s) 251, 364
MfeI CAATTG 1 cut(s) 288
MluCI AATT 5 cut(s) 55, 223, 288, 327, 337
MnlI CCTC 2 cut(s) 37, 80
MspR9I CCNGG 1 cut(s) 262
MunI CAATTG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 3 cut(s) 280, 298, 373
PfeI GAWTC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
Sau3AI GATC 3 cut(s) 280, 298, 373
ScrFI CCNGG 1 cut(s) 262
SetI ASST 6 cut(s) 83, 146, 158, 211, 249, 310
SfaNI GCATC 1 cut(s) 124
SfcI CTRYAG 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 5 cut(s) 55, 223, 288, 327, 337
SspMI CTAG 1 cut(s) 365
StyD4I CCNGG 1 cut(s) 260
TasI AATT 5 cut(s) 55, 223, 288, 327, 337
TfiI GAWTC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 90
XapI RAATTY 3 cut(s) 223, 327, 337
XspI CTAG 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.