Rh5BG427500

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0002165
Physical Location & Seq
Reverse (-)
69163206 .. 69164121
916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG427500.1

Sequence Viewer

Length: 834 bp
ATGGATTCTGCTCAAGTCCCCCGTGTTGCAATAGATTTAGGAGAGGATATTTTAAATTATGCCAATATCCTCAATGGAAGCTCAGGGCATAATGATAATATGTTTTCAACGTTTGGTTATCCTGCATCTGGCGATGCTATTAGCTATAGTCAGAACCCTATTCAAAGTCAAGTTGCTGCTCAAAGTGAACCCAAAACCACAAAGAAAGCTAAAAGAGCCAAGAATTTCTCCATTCAAGAAGACAACCTTCTTGTGTCTGCCTGGCTTAATACTACCCTTGGTCCAGCAATAGGAAATGATCAAAAAGGTGCTGCTTATTGGAAAAGAATTTGGGACTATTTCTATGCTGAGAAGAACTTTGAACTAGAGTGTGATCGTAATCAGGGTTCTCTCATGCATCGCTGGTCTGGAATTCAACTGGATGTGAACAAATTTTGTGGCTATTATGCTGAAATTGAAAGGACAAGAACAAGTGGTACAACTGAACAAGATAGGATTGTGGAAGCCAAACAAAAGTTTAGGAGGGAGCGAGGATACAACTTTAGATATGAGCATTGTTGGCATGTGTTGAAGTTCCACCCGAAATGGAACTTGGAACTCTCTAGGAAAAAACCAAAGAAAACTCATGCTACGGTTCCTGCTACTTCATCTCCTATCACTCCATCTGCTAGCCCAGATACAATAGATTTAGCTGATGGCAATGTTGAAGGCAATGAGTCTCCATGCTTGGAGAGGCCTATAGGCAAAAAGGCTGCCAAGACCTTGGCAAGGAAGGTAAAAGCTAAAGAGAAAGTGGAAGCAGCCCAATCTGAATTAGAGACTATTATGCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

277

Amino Acids

31.24

Weight (kDa)

8.86

Isoelectric Point (pI)

50.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 181 - 272 4.5e-15 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 110
AcsI RAATTY 4 cut(s) 223, 327, 411, 431
AfaI GTAC 1 cut(s) 478
AfiI CCNNNNNNNGG 3 cut(s) 128, 290, 768
AgsI TTSAA 8 cut(s) 108, 164, 236, 362, 416, 458, 571, 707
AjnI CCWGG 1 cut(s) 260
AjuI GAANNNNNNNTTGG 2 cut(s) 575, 607
AluBI AGCT 5 cut(s) 81, 144, 209, 692, 782
AluI AGCT 5 cut(s) 81, 144, 209, 692, 782
Alw26I GTCTC 2 cut(s) 723, 812
AoxI GGCC 1 cut(s) 734
ApeKI GCWGC 4 cut(s) 176, 311, 752, 800
ApoI RAATTY 4 cut(s) 223, 327, 411, 431
AspS9I GGNCC 1 cut(s) 281
AsuNHI GCTAGC 1 cut(s) 668
AvaII GGWCC 1 cut(s) 281
BbsI GAAGAC 1 cut(s) 246
BbvI GCAGC 4 cut(s) 163, 298, 739, 812
BccI CCATC 2 cut(s) 670, 689
BciT130I CCWGG 1 cut(s) 262
BciVI GTATCC 1 cut(s) 527
BclI TGATCA 1 cut(s) 298
BcoDI GTCTC 2 cut(s) 723, 812
BfaI CTAG 3 cut(s) 365, 603, 669
BfmI CTRYAG 2 cut(s) 145, 738
BfuI GTATCC 1 cut(s) 527
BisI GCNGC 4 cut(s) 177, 312, 753, 801
BlsI GCNGC 4 cut(s) 178, 313, 754, 802
Bme1390I CCNGG 1 cut(s) 262
Bme18I GGWCC 1 cut(s) 281
BmgT120I GGNCC 1 cut(s) 281
BmiI GGNNCC 1 cut(s) 636
BmrFI CCNGG 1 cut(s) 262
BmsI GCATC 3 cut(s) 124, 134, 406
BmtI GCTAGC 1 cut(s) 672
BpiI GAAGAC 1 cut(s) 246
Bpu10I CCTNAGC 1 cut(s) 82
BsaBI GATNNNNATC 1 cut(s) 378
BsaJI CCNNGG 2 cut(s) 277, 762
BsaXI ACNNNNNCTCC 2 cut(s) 634, 664
Bsc4I CCNNNNNNNGG 3 cut(s) 128, 290, 768
Bse1I ACTGG 1 cut(s) 423
Bse3DI GCAATG 2 cut(s) 706, 718
Bse8I GATNNNNATC 1 cut(s) 378
BseBI CCWGG 1 cut(s) 262
BseDI CCNNGG 2 cut(s) 277, 762
BseGI GGATG 1 cut(s) 427
BseJI GATNNNNATC 1 cut(s) 378
BseLI CCNNNNNNNGG 3 cut(s) 128, 290, 768
BseMI GCAATG 2 cut(s) 706, 718
BseMII CTCAG 2 cut(s) 96, 339
BseNI ACTGG 1 cut(s) 423
BseXI GCAGC 4 cut(s) 163, 298, 739, 812
BshFI GGCC 1 cut(s) 736
BslFI GGGAC 2 cut(s) 2, 347
BslI CCNNNNNNNGG 3 cut(s) 128, 290, 768
BsmAI GTCTC 2 cut(s) 723, 812
BsmFI GGGAC 2 cut(s) 2, 347
BsnI GGCC 1 cut(s) 736
Bsp143I GATC 2 cut(s) 298, 373
BspANI GGCC 1 cut(s) 736
BspCNI CTCAG 2 cut(s) 95, 340
BspLI GGNNCC 1 cut(s) 636
BspOI GCTAGC 1 cut(s) 672
BsrDI GCAATG 2 cut(s) 706, 718
BsrI ACTGG 1 cut(s) 423
BssECI CCNNGG 2 cut(s) 277, 762
BssMI GATC 2 cut(s) 298, 373
BssT1I CCWWGG 2 cut(s) 277, 762
Bst2UI CCWGG 1 cut(s) 262
Bst4CI ACNGT 1 cut(s) 634
BstC8I GCNNGC 1 cut(s) 670
BstDEI CTNAG 2 cut(s) 82, 348
BstENI CCTNNNNNAGG 1 cut(s) 766
BstF5I GGATG 1 cut(s) 427
BstKTI GATC 2 cut(s) 301, 376
BstMAI GTCTC 2 cut(s) 723, 812
BstMBI GATC 2 cut(s) 298, 373
BstMWI GCNNNNNNNGC 2 cut(s) 215, 559
BstNI CCWGG 1 cut(s) 262
BstNSI RCATGY 1 cut(s) 566
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 2 cut(s) 145, 738
BstV1I GCAGC 4 cut(s) 163, 298, 739, 812
BstV2I GAAGAC 1 cut(s) 246
BstXI CCANNNNNNTGG 1 cut(s) 763
BsuI GTATCC 1 cut(s) 527
BsuRI GGCC 1 cut(s) 736
BtgZI GCGATG 2 cut(s) 147, 383
BtsCI GGATG 1 cut(s) 427
Cac8I GCNNGC 1 cut(s) 670
Cfr13I GGNCC 1 cut(s) 281
Csp6I GTAC 1 cut(s) 477
CspCI CAANNNNNGTGG 2 cut(s) 418, 453
CviAII CATG 4 cut(s) 394, 563, 626, 723
CviQI GTAC 1 cut(s) 477
DdeI CTNAG 2 cut(s) 82, 348
DpnI GATC 2 cut(s) 300, 375
DpnII GATC 2 cut(s) 298, 373
DraI TTTAAA 1 cut(s) 54
Eco130I CCWWGG 2 cut(s) 277, 762
Eco147I AGGCCT 1 cut(s) 736
Eco47I GGWCC 1 cut(s) 281
EcoNI CCTNNNNNAGG 1 cut(s) 766
EcoRI GAATTC 1 cut(s) 411
EcoRII CCWGG 1 cut(s) 260
EcoT14I CCWWGG 2 cut(s) 277, 762
EcoT22I ATGCAT 1 cut(s) 399
ErhI CCWWGG 2 cut(s) 277, 762
FaeI CATG 4 cut(s) 397, 566, 629, 726
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 2 cut(s) 2, 347
FatI CATG 4 cut(s) 393, 562, 625, 722
FbaI TGATCA 1 cut(s) 298
Fnu4HI GCNGC 4 cut(s) 177, 312, 753, 801
FokI GGATG 1 cut(s) 434
Fsp4HI GCNGC 4 cut(s) 177, 312, 753, 801
FspBI CTAG 3 cut(s) 365, 603, 669
GluI GCNGC 4 cut(s) 177, 312, 753, 801
HaeIII GGCC 1 cut(s) 736
Hin1II CATG 4 cut(s) 397, 566, 629, 726
HinfI GANTC 2 cut(s) 5, 716
Hpy166II GTNNAC 2 cut(s) 188, 427
Hpy188I TCNGA 3 cut(s) 153, 811, 833
Hpy188III TCNNGA 2 cut(s) 236, 408
Hpy8I GTNNAC 2 cut(s) 188, 427
HpyAV CCTTC 3 cut(s) 257, 701, 766
HpyCH4III ACNGT 1 cut(s) 634
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 3 cut(s) 29, 125, 397
HpyF10VI GCNNNNNNNGC 2 cut(s) 215, 559
HpyF3I CTNAG 2 cut(s) 82, 348
HpySE526I ACGT 1 cut(s) 110
Hsp92II CATG 4 cut(s) 397, 566, 629, 726
Ksp22I TGATCA 1 cut(s) 298
Kzo9I GATC 2 cut(s) 298, 373
LmnI GCTCC 1 cut(s) 526
Lsp1109I GCAGC 4 cut(s) 163, 298, 739, 812
LweI GCATC 3 cut(s) 124, 134, 406
MaeI CTAG 3 cut(s) 365, 603, 669
MaeII ACGT 1 cut(s) 110
MalI GATC 2 cut(s) 300, 375
MboI GATC 2 cut(s) 298, 373
MboII GAAGA 2 cut(s) 251, 364
MluCI AATT 7 cut(s) 55, 223, 327, 411, 431, 453, 812
MlyI GAGTC 1 cut(s) 725
MnlI CCTC 5 cut(s) 37, 80, 516, 524, 726
Mph1103I ATGCAT 1 cut(s) 399
MseI TTAA 2 cut(s) 53, 267
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 2 cut(s) 215, 559
NdeII GATC 2 cut(s) 298, 373
NheI GCTAGC 1 cut(s) 668
NlaIII CATG 4 cut(s) 397, 566, 629, 726
NlaIV GGNNCC 1 cut(s) 636
NsiI ATGCAT 1 cut(s) 399
NspI RCATGY 1 cut(s) 566
PceI AGGCCT 1 cut(s) 736
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 4 cut(s) 178, 313, 754, 802
PleI GAGTC 1 cut(s) 724
PpsI GAGTC 1 cut(s) 724
Psp1406I AACGTT 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 636
PspPI GGNCC 1 cut(s) 281
PsrI GAACNNNNNNTAC 4 cut(s) 370, 402, 460, 492
RsaI GTAC 1 cut(s) 478
RsaNI GTAC 1 cut(s) 477
SaqAI TTAA 2 cut(s) 53, 267
SatI GCNGC 4 cut(s) 177, 312, 753, 801
Sau3AI GATC 2 cut(s) 298, 373
Sau96I GGNCC 1 cut(s) 281
SchI GAGTC 1 cut(s) 725
ScrFI CCNGG 1 cut(s) 262
SfaNI GCATC 3 cut(s) 124, 134, 406
SfcI CTRYAG 2 cut(s) 145, 738
SinI GGWCC 1 cut(s) 281
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 7 cut(s) 55, 223, 327, 411, 431, 453, 812
SseBI AGGCCT 1 cut(s) 736
SspMI CTAG 3 cut(s) 365, 603, 669
StuI AGGCCT 1 cut(s) 736
StyD4I CCNGG 1 cut(s) 260
StyI CCWWGG 2 cut(s) 277, 762
TaaI ACNGT 1 cut(s) 634
TaiI ACGT 1 cut(s) 113
TasI AATT 7 cut(s) 55, 223, 327, 411, 431, 453, 812
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 53, 267
Tru9I TTAA 2 cut(s) 53, 267
TseI GCWGC 4 cut(s) 176, 311, 752, 800
TspDTI ATGAA 1 cut(s) 636
VpaK11BI GGWCC 1 cut(s) 281
XagI CCTNNNNNAGG 1 cut(s) 766
XapI RAATTY 4 cut(s) 223, 327, 411, 431
XceI RCATGY 1 cut(s) 566
XspI CTAG 3 cut(s) 365, 603, 669
Zsp2I ATGCAT 1 cut(s) 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.