Rh3CG136500

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
11188955 .. 11189213
259 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG136500.1

Sequence Viewer

Length: 177 bp
ATGCATCGCTGGTCTGGAATTCAACTAGATGTGAACAAGTTTTGTGGCTATTATGCTGAAATTGAAGGACAAGAGCAAGTGGTACAACTGAACAAGATAGGATTGTGGAAGCCAAACAAAAGTTTAGGAGGGAGCGAGACTACAACTTTACATATGAGCATTGTTGACATGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.59

Weight (kDa)

6.01

Isoelectric Point (pI)

71.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 18
AfaI GTAC 1 cut(s) 84
AflIII ACRYGT 1 cut(s) 168
AgsI TTSAA 2 cut(s) 23, 65
Alw26I GTCTC 1 cut(s) 131
ApoI RAATTY 1 cut(s) 18
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 26
BmsI GCATC 1 cut(s) 13
BsmAI GTCTC 1 cut(s) 131
BstMAI GTCTC 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 172
Csp6I GTAC 1 cut(s) 83
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 1 cut(s) 169
CviJI RGCY 2 cut(s) 48, 112
CviKI_1 RGCY 2 cut(s) 48, 112
CviQI GTAC 1 cut(s) 83
EcoRI GAATTC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 172
FaiI YATR 4 cut(s) 54, 153, 155, 170
FatI CATG 1 cut(s) 168
FauNDI CATATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 26
FspEI CC 9 cut(s) 30, 51, 65, 84, 91, 111, 114, 115, 126
Hin1II CATG 1 cut(s) 172
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
Hpy166II GTNNAC 2 cut(s) 34, 166
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 2 cut(s) 34, 166
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 172
LmnI GCTCC 1 cut(s) 132
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 26
MluCI AATT 2 cut(s) 18, 60
MnlI CCTC 1 cut(s) 122
Mph1103I ATGCAT 1 cut(s) 6
NdeI CATATG 1 cut(s) 153
NlaIII CATG 1 cut(s) 172
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 172
PciI ACATGT 1 cut(s) 168
PscI ACATGT 1 cut(s) 168
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 8 cut(s) 22, 27, 38, 49, 83, 89, 106, 148
Sse9I AATT 2 cut(s) 18, 60
SspMI CTAG 1 cut(s) 26
TasI AATT 2 cut(s) 18, 60
XapI RAATTY 1 cut(s) 18
XceI RCATGY 1 cut(s) 172
XspI CTAG 1 cut(s) 26
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.