Rmu_sc0010369.1_g000006

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010369.1
Physical Location & Seq
Reverse (-)
20801 .. 21184
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010369.1_g000006.1.cds

Sequence Viewer

Length: 384 bp
atggattctgctcaagtcccccgtgctgcaatagatttaggagaggatattttaaattatgccaatatcctcaatggaagctcagggcataatgataatatgttttcaacgtttggttatcctgcatctggtgatgctattagctatagtcagaaccctattcaaagtcaagttgctgttcaaagtgaaaccaaaaccacaaagaaagctaaaagagccaagaatttctccattcaagaagacaaccttcttgtgtcttcctggctcaatactacccttgatccagcaatgggaaatgatcaaaaaggtgctgcttattggaaaagaatttgggtgtatttctatgaggagaagaactttgaactggagtgtgatcgcaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.27

Weight (kDa)

4.88

Isoelectric Point (pI)

51.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 110
AclWI GGATC 1 cut(s) 275
AcsI RAATTY 2 cut(s) 223, 327
AfiI CCNNNNNNNGG 2 cut(s) 128, 290
AgsI TTSAA 5 cut(s) 108, 164, 182, 236, 362
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 3 cut(s) 81, 144, 209
AluI AGCT 3 cut(s) 81, 144, 209
AlwI GGATC 1 cut(s) 275
ApeKI GCWGC 2 cut(s) 26, 311
ApoI RAATTY 2 cut(s) 223, 327
AsuHPI GGTGA 1 cut(s) 143
BbsI GAAGAC 2 cut(s) 246, 249
BbvI GCAGC 2 cut(s) 13, 298
BciT130I CCWGG 1 cut(s) 262
BclI TGATCA 1 cut(s) 298
BfmI CTRYAG 1 cut(s) 145
BisI GCNGC 2 cut(s) 27, 312
BlsI GCNGC 2 cut(s) 28, 313
Bme1390I CCNGG 1 cut(s) 262
BmrFI CCNGG 1 cut(s) 262
BmsI GCATC 2 cut(s) 124, 134
BpiI GAAGAC 2 cut(s) 246, 249
Bpu10I CCTNAGC 1 cut(s) 82
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 290
Bse1I ACTGG 1 cut(s) 369
Bse3DI GCAATG 1 cut(s) 294
BseBI CCWGG 1 cut(s) 262
BseLI CCNNNNNNNGG 2 cut(s) 128, 290
BseMI GCAATG 1 cut(s) 294
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 369
BseRI GAGGAG 1 cut(s) 362
BseXI GCAGC 2 cut(s) 13, 298
BslFI GGGAC 1 cut(s) 2
BslI CCNNNNNNNGG 2 cut(s) 128, 290
BsmFI GGGAC 1 cut(s) 2
Bsp143I GATC 3 cut(s) 280, 298, 373
BspCNI CTCAG 1 cut(s) 95
BspPI GGATC 1 cut(s) 275
BsrDI GCAATG 1 cut(s) 294
BsrI ACTGG 1 cut(s) 369
BssMI GATC 3 cut(s) 280, 298, 373
Bst2UI CCWGG 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 82
BstKTI GATC 3 cut(s) 283, 301, 376
BstMBI GATC 3 cut(s) 280, 298, 373
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 145
BstV1I GCAGC 2 cut(s) 13, 298
BstV2I GAAGAC 2 cut(s) 246, 249
CviJI RGCY 5 cut(s) 81, 144, 209, 218, 265
CviKI_1 RGCY 5 cut(s) 81, 144, 209, 218, 265
DdeI CTNAG 1 cut(s) 82
DpnI GATC 3 cut(s) 282, 300, 375
DpnII GATC 3 cut(s) 280, 298, 373
DraI TTTAAA 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 260
FaiI YATR 5 cut(s) 60, 90, 101, 147, 345
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 1 cut(s) 2
FbaI TGATCA 1 cut(s) 298
Fnu4HI GCNGC 2 cut(s) 27, 312
Fsp4HI GCNGC 2 cut(s) 27, 312
GluI GCNGC 2 cut(s) 27, 312
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 236
HpyAV CCTTC 1 cut(s) 257
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 2 cut(s) 29, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 1 cut(s) 82
HpySE526I ACGT 1 cut(s) 110
Ksp22I TGATCA 1 cut(s) 298
Kzo9I GATC 3 cut(s) 280, 298, 373
LpnPI CCDG 7 cut(s) 69, 114, 135, 247, 274, 297, 350
Lsp1109I GCAGC 2 cut(s) 13, 298
LweI GCATC 2 cut(s) 124, 134
MaeII ACGT 1 cut(s) 110
MalI GATC 3 cut(s) 282, 300, 375
MboI GATC 3 cut(s) 280, 298, 373
MboII GAAGA 3 cut(s) 249, 251, 364
MluCI AATT 4 cut(s) 55, 223, 327, 379
MnlI CCTC 3 cut(s) 37, 80, 340
MseI TTAA 2 cut(s) 53, 382
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 3 cut(s) 280, 298, 373
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 2 cut(s) 28, 313
Psp1406I AACGTT 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
SaqAI TTAA 2 cut(s) 53, 382
SatI GCNGC 2 cut(s) 27, 312
Sau3AI GATC 3 cut(s) 280, 298, 373
ScrFI CCNGG 1 cut(s) 262
SetI ASST 6 cut(s) 83, 113, 146, 211, 249, 310
SfaNI GCATC 2 cut(s) 124, 134
SfcI CTRYAG 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 4 cut(s) 55, 223, 327, 379
StyD4I CCNGG 1 cut(s) 260
TaiI ACGT 1 cut(s) 113
TasI AATT 4 cut(s) 55, 223, 327, 379
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 53, 382
Tru9I TTAA 2 cut(s) 53, 382
TseI GCWGC 2 cut(s) 26, 311
XapI RAATTY 2 cut(s) 223, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.