RchiOBHm_Chr2g0130211

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
46154620 .. 46155990
1371 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50172

Sequence Viewer

Length: 165 bp
ATGGGATCGCTTAATCCTATTCTCGCCTCCGCCGAAAAACCGAGATTGGATTCACAAAAACACAAGATTGGGAGGTCACCAACCAAGCCTGGAGCTGATTCCAAGCAGAATCGGTTCACACTGTCACAAAAACTGAGGATTCGGTTTGTACAGTTGTTGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.05

Weight (kDa)

11.49

Isoelectric Point (pI)

45.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 30
AclWI GGATC 1 cut(s) 13
AfaI GTAC 1 cut(s) 150
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwI GGATC 1 cut(s) 13
Asp700I GAANNNNTTC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 69
BciT130I CCWGG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 90
BpmI CTGGAG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 125
Bsp1407I TGTACA 1 cut(s) 148
Bsp143I GATC 1 cut(s) 5
BspACI CCGC 1 cut(s) 30
BspCNI CTCAG 1 cut(s) 126
BspPI GGATC 1 cut(s) 13
BsrGI TGTACA 1 cut(s) 148
BssMI GATC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 2 cut(s) 123, 153
BstAUI TGTACA 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 134
BstEII GGTNACC 1 cut(s) 75
BstKTI GATC 1 cut(s) 8
BstMBI GATC 1 cut(s) 5
BstNI CCWGG 1 cut(s) 90
BstPI GGTNACC 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 88
BtsIMutI CAGTG 1 cut(s) 119
Csp6I GTAC 1 cut(s) 149
CviJI RGCY 2 cut(s) 88, 95
CviKI_1 RGCY 2 cut(s) 88, 95
CviQI GTAC 1 cut(s) 149
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
EciI GGCGGA 1 cut(s) 19
Eco91I GGTNACC 1 cut(s) 75
EcoO65I GGTNACC 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 88
GsuI CTGGAG 1 cut(s) 111
HinfI GANTC 4 cut(s) 50, 98, 109, 139
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 162
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4III ACNGT 2 cut(s) 123, 153
HpyF3I CTNAG 1 cut(s) 134
Kzo9I GATC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 75, 102
MaeIII GTNAC 2 cut(s) 75, 123
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MnlI CCTC 3 cut(s) 37, 66, 129
MroXI GAANNNNTTC 1 cut(s) 113
MseI TTAA 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
NdeII GATC 1 cut(s) 5
NmuCI GTSAC 2 cut(s) 75, 123
PcsI WCGNNNNNNNCGW 1 cut(s) 30
PdmI GAANNNNTTC 1 cut(s) 113
PfeI GAWTC 4 cut(s) 50, 98, 109, 139
Psp6I CCWGG 1 cut(s) 88
PspEI GGTNACC 1 cut(s) 75
PspGI CCWGG 1 cut(s) 88
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 5
ScrFI CCNGG 1 cut(s) 90
SetI ASST 2 cut(s) 77, 97
SgeI CNNG 7 cut(s) 35, 54, 76, 97, 101, 102, 115
SsiI CCGC 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 2 cut(s) 123, 153
TatI WGTACW 1 cut(s) 148
TfiI GAWTC 4 cut(s) 50, 98, 109, 139
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 1 cut(s) 126
TseFI GTSAC 2 cut(s) 75, 123
Tsp45I GTSAC 2 cut(s) 75, 123
TspRI CASTG 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.