Rh7DG365300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0002605
Physical Location & Seq
Reverse (-)
48939541 .. 48940408
868 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG365300.1

Sequence Viewer

Length: 336 bp
ATGTACTTCATCTGTCCTCCCACAACTCAGAAAGGAACTTACAACCTTCTAAAAATTGAAGATTCTGCTATCCACCTAGGTGATGGTCACCTGGTGACGTGGCAGAATGACAGCCACAAATTGTTCATTGAGGTAGAAAGGAGTAGAGGTACCTCCCTCTGGTATGCTCCCCAAACTCCCAAAGCCATATCACCGATCAAGGGATCGCTTAATCCTACTCGCCTCCGCCGAAAAACCAAGATTGGATTCACAAAAAACAAGATTGGGAGGTCATCAACCAAGCCTGGAGCCGATTCCAAGCAGAAATCTGTTCACACTGTCACAAAAACTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.47

Weight (kDa)

10.11

Isoelectric Point (pI)

54.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 149
AccB1I GGYRCC 1 cut(s) 149
AciI CCGC 1 cut(s) 226
AclWI GGATC 1 cut(s) 211
AdeI CACNNNGTG 1 cut(s) 94
AfaI GTAC 2 cut(s) 5, 151
AfiI CCNNNNNNNGG 2 cut(s) 159, 200
AgsI TTSAA 1 cut(s) 59
AjiI CACGTC 1 cut(s) 99
AjnI CCWGG 2 cut(s) 90, 283
AjuI GAANNNNNNNTTGG 2 cut(s) 230, 262
AleI CACNNNNGTG 1 cut(s) 78
AlwI GGATC 1 cut(s) 211
Asp718I GGTACC 1 cut(s) 149
AspA2I CCTAGG 1 cut(s) 76
AsuHPI GGTGA 4 cut(s) 80, 92, 106, 183
AvrII CCTAGG 1 cut(s) 76
BanI GGYRCC 1 cut(s) 149
BccI CCATC 1 cut(s) 77
BciT130I CCWGG 2 cut(s) 92, 285
BfaI CTAG 1 cut(s) 77
BlnI CCTAGG 1 cut(s) 76
Bme1390I CCNGG 2 cut(s) 92, 285
BmgBI CACGTC 1 cut(s) 99
BmiI GGNNCC 2 cut(s) 151, 289
BmrFI CCNGG 2 cut(s) 92, 285
BpmI CTGGAG 1 cut(s) 306
BsaJI CCNNGG 1 cut(s) 76
BsaXI ACNNNNNCTCC 2 cut(s) 133, 163
Bsc4I CCNNNNNNNGG 2 cut(s) 159, 200
BseBI CCWGG 2 cut(s) 92, 285
BseDI CCNNGG 1 cut(s) 76
BseLI CCNNNNNNNGG 2 cut(s) 159, 200
BseMII CTCAG 2 cut(s) 41, 321
BshNI GGYRCC 1 cut(s) 149
BslI CCNNNNNNNGG 2 cut(s) 159, 200
Bsp143I GATC 2 cut(s) 195, 203
BspACI CCGC 1 cut(s) 226
BspCNI CTCAG 2 cut(s) 40, 322
BspLI GGNNCC 2 cut(s) 151, 289
BspPI GGATC 1 cut(s) 211
BspT107I GGYRCC 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 2 cut(s) 195, 203
BssT1I CCWWGG 1 cut(s) 76
Bst2UI CCWGG 2 cut(s) 92, 285
Bst4CI ACNGT 1 cut(s) 319
BstDEI CTNAG 2 cut(s) 27, 330
BstEII GGTNACC 1 cut(s) 86
BstKTI GATC 2 cut(s) 198, 206
BstMBI GATC 2 cut(s) 195, 203
BstNI CCWGG 2 cut(s) 92, 285
BstPI GGTNACC 1 cut(s) 86
BstSCI CCNGG 2 cut(s) 90, 283
BtrI CACGTC 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 315
CsiI ACCWGGT 1 cut(s) 90
Csp6I GTAC 2 cut(s) 4, 150
CviJI RGCY 4 cut(s) 114, 185, 283, 290
CviKI_1 RGCY 4 cut(s) 114, 185, 283, 290
CviQI GTAC 2 cut(s) 4, 150
DdeI CTNAG 2 cut(s) 27, 330
DpnI GATC 2 cut(s) 197, 205
DpnII GATC 2 cut(s) 195, 203
DraIII CACNNNGTG 1 cut(s) 94
EciI GGCGGA 1 cut(s) 215
Eco130I CCWWGG 1 cut(s) 76
Eco91I GGTNACC 1 cut(s) 86
EcoO65I GGTNACC 1 cut(s) 86
EcoRII CCWGG 2 cut(s) 90, 283
EcoT14I CCWWGG 1 cut(s) 76
ErhI CCWWGG 1 cut(s) 76
FaiI YATR 2 cut(s) 165, 188
FspBI CTAG 1 cut(s) 77
GsuI CTGGAG 1 cut(s) 306
HinfI GANTC 3 cut(s) 62, 246, 293
HphI GGTGA 4 cut(s) 80, 92, 106, 183
Hpy166II GTNNAC 1 cut(s) 313
Hpy188I TCNGA 1 cut(s) 30
Hpy8I GTNNAC 1 cut(s) 313
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4IV ACGT 1 cut(s) 98
HpyF3I CTNAG 2 cut(s) 27, 330
HpySE526I ACGT 1 cut(s) 98
KpnI GGTACC 1 cut(s) 153
Kzo9I GATC 2 cut(s) 195, 203
LmnI GCTCC 2 cut(s) 172, 287
LpnPI CCDG 5 cut(s) 77, 104, 145, 270, 297
MabI ACCWGGT 1 cut(s) 90
MaeI CTAG 1 cut(s) 77
MaeII ACGT 1 cut(s) 98
MaeIII GTNAC 3 cut(s) 86, 94, 319
MalI GATC 2 cut(s) 197, 205
MboI GATC 2 cut(s) 195, 203
MboII GAAGA 1 cut(s) 71
MluCI AATT 2 cut(s) 54, 119
MnlI CCTC 7 cut(s) 27, 124, 140, 163, 167, 233, 261
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 78
MspR9I CCNGG 2 cut(s) 92, 285
MvaI CCWGG 2 cut(s) 92, 285
NdeII GATC 2 cut(s) 195, 203
NlaIV GGNNCC 2 cut(s) 151, 289
NmuCI GTSAC 3 cut(s) 86, 94, 319
OliI CACNNNNGTG 1 cut(s) 78
PcsI WCGNNNNNNNCGW 1 cut(s) 226
PfeI GAWTC 3 cut(s) 62, 246, 293
Psp6I CCWGG 2 cut(s) 90, 283
PspEI GGTNACC 1 cut(s) 86
PspGI CCWGG 2 cut(s) 90, 283
PspN4I GGNNCC 2 cut(s) 151, 289
RsaI GTAC 2 cut(s) 5, 151
RsaNI GTAC 2 cut(s) 4, 150
RseI CAYNNNNRTG 1 cut(s) 78
SaqAI TTAA 1 cut(s) 210
Sau3AI GATC 2 cut(s) 195, 203
ScrFI CCNGG 2 cut(s) 92, 285
SetI ASST 9 cut(s) 48, 78, 82, 93, 101, 135, 151, 155, 272
SexAI ACCWGGT 1 cut(s) 90
SmiMI CAYNNNNRTG 1 cut(s) 78
Sse9I AATT 2 cut(s) 54, 119
SsiI CCGC 1 cut(s) 226
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 2 cut(s) 90, 283
StyI CCWWGG 1 cut(s) 76
TaaI ACNGT 1 cut(s) 319
TaiI ACGT 1 cut(s) 101
TasI AATT 2 cut(s) 54, 119
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 3 cut(s) 62, 246, 293
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 1 cut(s) 322
TseFI GTSAC 3 cut(s) 86, 94, 319
Tsp45I GTSAC 3 cut(s) 86, 94, 319
TspDTI ATGAA 1 cut(s) 115
TspRI CASTG 1 cut(s) 322
XcmI CCANNNNNNNNNTGG 1 cut(s) 80
XmaJI CCTAGG 1 cut(s) 76
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.