RchiOBHm_Chr6g0253121

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
8287223 .. 8288382
1160 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22696

Sequence Viewer

Length: 162 bp
ATGCTCCCCAAAGCCATATCGCCGATCATGGGATCGCTTAATCCTACTCGCCTCCGCCCAAAAACCAAGATTGGATTCACAAAAAACAAGATTGGGAGGTCATCAACCAAGCCTGGAGCTGATTCCAAGCAGAAATCTGTTCACACTGTCACAAAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.75

Weight (kDa)

11.79

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 55
AclWI GGATC 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 29
AjnI CCWGG 1 cut(s) 112
AjuI GAANNNNNNNTTGG 2 cut(s) 59, 91
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AlwI GGATC 1 cut(s) 40
BciT130I CCWGG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
BpmI CTGGAG 1 cut(s) 135
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 29
Bsp143I GATC 2 cut(s) 24, 32
BspACI CCGC 1 cut(s) 55
BspPI GGATC 1 cut(s) 40
BssMI GATC 2 cut(s) 24, 32
Bst2UI CCWGG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 148
BstKTI GATC 2 cut(s) 27, 35
BstMBI GATC 2 cut(s) 24, 32
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 144
CviAII CATG 1 cut(s) 28
CviJI RGCY 3 cut(s) 14, 112, 119
CviKI_1 RGCY 3 cut(s) 14, 112, 119
DpnI GATC 2 cut(s) 26, 34
DpnII GATC 2 cut(s) 24, 32
EciI GGCGGA 1 cut(s) 44
EcoRII CCWGG 1 cut(s) 112
FaeI CATG 1 cut(s) 31
FaiI YATR 2 cut(s) 17, 29
FatI CATG 1 cut(s) 27
GsuI CTGGAG 1 cut(s) 135
Hin1II CATG 1 cut(s) 31
HinfI GANTC 2 cut(s) 75, 122
Hpy166II GTNNAC 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 148
Hsp92II CATG 1 cut(s) 31
Kzo9I GATC 2 cut(s) 24, 32
LmnI GCTCC 2 cut(s) 9, 116
LpnPI CCDG 2 cut(s) 99, 126
MaeIII GTNAC 1 cut(s) 148
MalI GATC 2 cut(s) 26, 34
MboI GATC 2 cut(s) 24, 32
MnlI CCTC 2 cut(s) 62, 90
MseI TTAA 1 cut(s) 39
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 2 cut(s) 24, 32
NlaIII CATG 1 cut(s) 31
NmuCI GTSAC 1 cut(s) 148
PfeI GAWTC 2 cut(s) 75, 122
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
SaqAI TTAA 1 cut(s) 39
Sau3AI GATC 2 cut(s) 24, 32
ScrFI CCNGG 1 cut(s) 114
SetI ASST 2 cut(s) 101, 121
SgeI CNNG 8 cut(s) 40, 60, 79, 100, 121, 125, 126, 139
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 148
TfiI GAWTC 2 cut(s) 75, 122
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
TspRI CASTG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.