RchiOBHm_Chr3g0481651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
27748138 .. 27749734
1597 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44659

Sequence Viewer

Length: 189 bp
ATGGGATTGCTTAATCCTTTTCTCGCCTCTGCCGAAAAACCAAGATTGGATTCACAAAAACACAAGATTGGGAGGTCATCAACCAAGCATGGAGCTGATTCCAAGCAGAAATCTGTTCACACTGTCACAAAAACTGAGGCTTCGGTTTGTACAGTTGGTGTCTTGATAGCCATAATACTCATTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.61

Weight (kDa)

9.9

Isoelectric Point (pI)

37.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 151
AjuI GAANNNNNNNTTGG 2 cut(s) 34, 66
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
BseMII CTCAG 1 cut(s) 126
Bsp1407I TGTACA 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 127
BsrGI TGTACA 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 124, 154
BstAUI TGTACA 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 120
Csp6I GTAC 1 cut(s) 150
CviAII CATG 1 cut(s) 89
CviJI RGCY 3 cut(s) 95, 140, 170
CviKI_1 RGCY 3 cut(s) 95, 140, 170
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 1 cut(s) 135
FaeI CATG 1 cut(s) 92
FaiI YATR 3 cut(s) 90, 173, 187
FatI CATG 1 cut(s) 88
Hin1II CATG 1 cut(s) 92
HinfI GANTC 2 cut(s) 50, 98
Hpy166II GTNNAC 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 163
Hpy8I GTNNAC 1 cut(s) 118
HpyCH4III ACNGT 2 cut(s) 124, 154
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 1 cut(s) 92
LmnI GCTCC 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 124
MnlI CCTC 3 cut(s) 37, 66, 130
MseI TTAA 1 cut(s) 12
NlaIII CATG 1 cut(s) 92
NmuCI GTSAC 1 cut(s) 124
PcsI WCGNNNNNNNCGW 1 cut(s) 30
PfeI GAWTC 2 cut(s) 50, 98
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 12
SetI ASST 2 cut(s) 77, 97
SgeI CNNG 7 cut(s) 35, 54, 76, 97, 101, 115, 175
TaaI ACNGT 2 cut(s) 124, 154
TatI WGTACW 1 cut(s) 149
TfiI GAWTC 2 cut(s) 50, 98
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspRI CASTG 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.