RchiOBHm_Chr2g0141931

Neprosin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0004413
Physical Location & Seq
Reverse (-)
59502153 .. 59502380
228 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51217

Sequence Viewer

Length: 228 bp
ATGGGCCGTGGCCATTTCCCTCATGAAGGCTATGGAAAAGCGAGTTATTTTTACCATGTTCAGTATGCGGACCAACCTGGCTCTTTCAAAGATGCTACAAGTCTCATCCCTTACGCAACAAAGCCTTTATGTTATGATATAATTGTTTTTCCTCCTAGGGAAGGTACTTCTTATGGAACTAATTTCTTTTATGGAGGTCCTGGATACTCCAGTTCTTGTCAAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Neprosin Neprosin_AP

Protein Analysis

75

Amino Acids

8.33

Weight (kDa)

6.8

Isoelectric Point (pI)

26.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Neprosin PF03080 1 - 67 9.7e-12 Neprosin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 10
AfaI GTAC 1 cut(s) 166
AfiI CCNNNNNNNGG 2 cut(s) 26, 161
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 2 cut(s) 76, 199
Alw26I GTCTC 1 cut(s) 107
AoxI GGCC 2 cut(s) 4, 10
AspA2I CCTAGG 1 cut(s) 155
AspS9I GGNCC 3 cut(s) 4, 70, 197
AvaII GGWCC 2 cut(s) 70, 197
AvrII CCTAGG 1 cut(s) 155
BaeI ACNNNNGTAYC 1 cut(s) 196
BalI TGGCCA 1 cut(s) 12
BciT130I CCWGG 2 cut(s) 78, 201
BciVI GTATCC 1 cut(s) 197
BcoDI GTCTC 1 cut(s) 107
BfaI CTAG 1 cut(s) 156
BfuI GTATCC 1 cut(s) 197
BlnI CCTAGG 1 cut(s) 155
Bme1390I CCNGG 2 cut(s) 78, 201
Bme18I GGWCC 2 cut(s) 70, 197
BmgT120I GGNCC 3 cut(s) 4, 70, 197
BmrFI CCNGG 2 cut(s) 78, 201
BmsI GCATC 1 cut(s) 82
BpmI CTGGAG 1 cut(s) 193
BsaJI CCNNGG 2 cut(s) 7, 155
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 161
Bse1I ACTGG 1 cut(s) 210
BseBI CCWGG 2 cut(s) 78, 201
BseDI CCNNGG 2 cut(s) 7, 155
BseGI GGATG 1 cut(s) 105
BseLI CCNNNNNNNGG 2 cut(s) 26, 161
BseNI ACTGG 1 cut(s) 210
BshFI GGCC 2 cut(s) 6, 12
BslI CCNNNNNNNGG 2 cut(s) 26, 161
BsmAI GTCTC 1 cut(s) 107
BsnI GGCC 2 cut(s) 6, 12
BspACI CCGC 1 cut(s) 68
BspANI GGCC 2 cut(s) 6, 12
BspHI TCATGA 1 cut(s) 22
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 2 cut(s) 7, 155
BssT1I CCWWGG 1 cut(s) 155
Bst2UI CCWGG 2 cut(s) 78, 201
BstDSI CCRYGG 1 cut(s) 7
BstENI CCTNNNNNAGG 2 cut(s) 24, 159
BstF5I GGATG 1 cut(s) 105
BstMAI GTCTC 1 cut(s) 107
BstNI CCWGG 2 cut(s) 78, 201
BstSCI CCNGG 2 cut(s) 76, 199
BsuI GTATCC 1 cut(s) 197
BsuRI GGCC 2 cut(s) 6, 12
BtgI CCRYGG 1 cut(s) 7
BtsCI GGATG 1 cut(s) 105
CciI TCATGA 1 cut(s) 22
Cfr13I GGNCC 3 cut(s) 4, 70, 197
Csp6I GTAC 1 cut(s) 165
CviAII CATG 2 cut(s) 23, 56
CviJI RGCY 5 cut(s) 6, 12, 30, 81, 124
CviKI_1 RGCY 5 cut(s) 6, 12, 30, 81, 124
CviQI GTAC 1 cut(s) 165
EaeI YGGCCR 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 155
Eco47I GGWCC 2 cut(s) 70, 197
EcoNI CCTNNNNNAGG 2 cut(s) 24, 159
EcoO109I RGGNCCY 1 cut(s) 197
EcoRII CCWGG 2 cut(s) 76, 199
EcoT14I CCWWGG 1 cut(s) 155
ErhI CCWWGG 1 cut(s) 155
FaeI CATG 2 cut(s) 26, 59
FaiI YATR 9 cut(s) 24, 33, 57, 66, 130, 135, 140, 174, 192
FatI CATG 2 cut(s) 22, 55
FokI GGATG 1 cut(s) 92
FspBI CTAG 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 193
HaeIII GGCC 2 cut(s) 6, 12
Hin1II CATG 2 cut(s) 26, 59
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 2 cut(s) 20, 155
Hsp92II CATG 2 cut(s) 26, 59
LpnPI CCDG 5 cut(s) 63, 90, 186, 213, 223
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 156
MlsI TGGCCA 1 cut(s) 12
MluCI AATT 2 cut(s) 141, 181
MluNI TGGCCA 1 cut(s) 12
MnlI CCTC 3 cut(s) 30, 162, 188
Mox20I TGGCCA 1 cut(s) 12
MscI TGGCCA 1 cut(s) 12
Msp20I TGGCCA 1 cut(s) 12
MspR9I CCNGG 2 cut(s) 78, 201
MvaI CCWGG 2 cut(s) 78, 201
NlaIII CATG 2 cut(s) 26, 59
PagI TCATGA 1 cut(s) 22
PfoI TCCNGGA 1 cut(s) 199
PpuMI RGGWCCY 1 cut(s) 197
Psp5II RGGWCCY 1 cut(s) 197
Psp6I CCWGG 2 cut(s) 76, 199
PspGI CCWGG 2 cut(s) 76, 199
PspPI GGNCC 3 cut(s) 4, 70, 197
PspPPI RGGWCCY 1 cut(s) 197
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
Sau96I GGNCC 3 cut(s) 4, 70, 197
ScrFI CCNGG 2 cut(s) 78, 201
SetI ASST 3 cut(s) 79, 166, 199
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 2 cut(s) 70, 197
Sse9I AATT 2 cut(s) 141, 181
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 2 cut(s) 76, 199
StyI CCWWGG 1 cut(s) 155
TasI AATT 2 cut(s) 141, 181
TspDTI ATGAA 1 cut(s) 39
VpaK11BI GGWCC 2 cut(s) 70, 197
XagI CCTNNNNNAGG 2 cut(s) 24, 159
XmaJI CCTAGG 1 cut(s) 155
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.