Rmu_co8265735.1_g000001

BEST Arabidopsis thaliana protein match is Protein of

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8265735.1
OG0004413
Physical Location & Seq
Forward (+)
1 .. 738
738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8265735.1_g000001.1.cds

Sequence Viewer

Length: 378 bp
gatccaaaggagggacattggtggatgcagttcggcaatgactatgtgttggggtattggccttctttcttgttctcgtacttggccgacagtgcttccatgattgagtggggaggtgaggttgtaaattcgcagtcggatggccgacacacctcaactcaaatgggcagtggtcgttttccggaggagggttttggaaaatcaagttatttcaggaacattcaagttgttgatagctccaataatctcaaggcccccaaagggttaggcaccttcaccgagcagtcaaactgctatgatgttcagacaggaagtaatggggattggggtcactacttttactatggaggaccaggtagaaacgcaaattgcccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Neprosin Neprosin_AP

Protein Analysis

125

Amino Acids

13.96

Weight (kDa)

4.95

Isoelectric Point (pI)

45.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 269
AccIII TCCGGA 1 cut(s) 181
AcoI YGGCCR 2 cut(s) 84, 142
AcsI RAATTY 1 cut(s) 127
AfaI GTAC 1 cut(s) 80
AfiI CCNNNNNNNGG 3 cut(s) 11, 188, 261
AgsI TTSAA 1 cut(s) 224
AjnI CCWGG 1 cut(s) 352
AluBI AGCT 1 cut(s) 237
AluI AGCT 1 cut(s) 237
Aor13HI TCCGGA 1 cut(s) 181
AoxI GGCC 4 cut(s) 59, 84, 142, 252
ApoI RAATTY 1 cut(s) 127
AspS9I GGNCC 2 cut(s) 253, 350
AsuHPI GGTGA 2 cut(s) 128, 268
AvaII GGWCC 1 cut(s) 350
BanI GGYRCC 1 cut(s) 269
BccI CCATC 1 cut(s) 134
BciT130I CCWGG 1 cut(s) 354
Bme1390I CCNGG 1 cut(s) 354
Bme18I GGWCC 1 cut(s) 350
BmgT120I GGNCC 2 cut(s) 253, 350
BmiI GGNNCC 2 cut(s) 255, 271
BmrFI CCNGG 1 cut(s) 354
BmsI GCATC 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 233
BsaWI WCCGGW 1 cut(s) 181
BsaXI ACNNNNNCTCC 2 cut(s) 105, 135
Bsc4I CCNNNNNNNGG 3 cut(s) 11, 188, 261
Bse3DI GCAATG 1 cut(s) 43
BseAI TCCGGA 1 cut(s) 181
BseBI CCWGG 1 cut(s) 354
BseGI GGATG 2 cut(s) 30, 145
BseLI CCNNNNNNNGG 3 cut(s) 11, 188, 261
BseMI GCAATG 1 cut(s) 43
BseRI GAGGAG 1 cut(s) 200
BshFI GGCC 4 cut(s) 61, 86, 144, 254
BshNI GGYRCC 1 cut(s) 269
BsiSI CCGG 1 cut(s) 182
BslFI GGGAC 1 cut(s) 27
BslI CCNNNNNNNGG 3 cut(s) 11, 188, 261
BsmFI GGGAC 1 cut(s) 27
BsnI GGCC 4 cut(s) 61, 86, 144, 254
Bsp13I TCCGGA 1 cut(s) 181
BspANI GGCC 4 cut(s) 61, 86, 144, 254
BspEI TCCGGA 1 cut(s) 181
BspLI GGNNCC 2 cut(s) 255, 271
BspT107I GGYRCC 1 cut(s) 269
BsrDI GCAATG 1 cut(s) 43
Bst2UI CCWGG 1 cut(s) 354
Bst4CI ACNGT 1 cut(s) 92
BstF5I GGATG 2 cut(s) 30, 145
BstKTI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 354
BstSCI CCNGG 1 cut(s) 352
BsuRI GGCC 4 cut(s) 61, 86, 144, 254
BtsCI GGATG 2 cut(s) 30, 145
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 2 cut(s) 97, 175
Cfr13I GGNCC 2 cut(s) 253, 350
CsiI ACCWGGT 1 cut(s) 352
Csp6I GTAC 1 cut(s) 79
CviAII CATG 2 cut(s) 100, 375
CviJI RGCY 5 cut(s) 61, 86, 144, 237, 254
CviKI_1 RGCY 5 cut(s) 61, 86, 144, 237, 254
CviQI GTAC 1 cut(s) 79
DpnI GATC 1 cut(s) 3
EaeI YGGCCR 2 cut(s) 84, 142
Eco47I GGWCC 1 cut(s) 350
EcoO109I RGGNCCY 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 352
FaeI CATG 2 cut(s) 103, 378
FaiI YATR 5 cut(s) 45, 101, 297, 345, 376
FaqI GGGAC 1 cut(s) 27
FatI CATG 2 cut(s) 99, 374
FokI GGATG 2 cut(s) 37, 152
HaeIII GGCC 4 cut(s) 61, 86, 144, 254
HapII CCGG 1 cut(s) 182
Hin1II CATG 2 cut(s) 103, 378
HpaII CCGG 1 cut(s) 182
HphI GGTGA 2 cut(s) 128, 268
Hpy188I TCNGA 2 cut(s) 139, 306
Hpy188III TCNNGA 2 cut(s) 182, 214
HpyAV CCTTC 2 cut(s) 72, 283
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 28
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Hsp92II CATG 2 cut(s) 103, 378
Kpn2I TCCGGA 1 cut(s) 181
LmnI GCTCC 1 cut(s) 242
LpnPI CCDG 5 cut(s) 195, 199, 294, 339, 366
LweI GCATC 1 cut(s) 15
MabI ACCWGGT 1 cut(s) 352
MaeIII GTNAC 1 cut(s) 329
MalI GATC 1 cut(s) 3
MluCI AATT 2 cut(s) 127, 367
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 7 cut(s) 4, 107, 112, 163, 178, 181, 341
MroI TCCGGA 1 cut(s) 181
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 354
MvaI CCWGG 1 cut(s) 354
MwoI GCNNNNNNNGC 1 cut(s) 92
NlaIII CATG 2 cut(s) 103, 378
NlaIV GGNNCC 2 cut(s) 255, 271
NmuCI GTSAC 1 cut(s) 329
Psp6I CCWGG 1 cut(s) 352
PspGI CCWGG 1 cut(s) 352
PspN4I GGNNCC 2 cut(s) 255, 271
PspPI GGNCC 2 cut(s) 253, 350
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
Sau96I GGNCC 2 cut(s) 253, 350
ScrFI CCNGG 1 cut(s) 354
SetI ASST 6 cut(s) 118, 123, 155, 239, 275, 358
SexAI ACCWGGT 1 cut(s) 352
SfaNI GCATC 1 cut(s) 15
SinI GGWCC 1 cut(s) 350
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
Sse9I AATT 2 cut(s) 127, 367
StyD4I CCNGG 1 cut(s) 352
TaaI ACNGT 1 cut(s) 92
TasI AATT 2 cut(s) 127, 367
TscAI CASTG 2 cut(s) 97, 175
TseFI GTSAC 1 cut(s) 329
Tsp45I GTSAC 1 cut(s) 329
TspRI CASTG 2 cut(s) 97, 175
VpaK11BI GGWCC 1 cut(s) 350
XapI RAATTY 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.