Rmu_sc0009946.1_g000003

Neprosin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009946.1
OG0004413
Physical Location & Seq
Forward (+)
11266 .. 13393
2128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009946.1_g000003.1.cds

Sequence Viewer

Length: 582 bp
atggaacccagttcaactccaagtggagtaaaaccaataaacaaccaagccaagcttattcaagattggttcaagaatggagaatgccctgacggaacgattcccatcattaggccacaaagatatgattataattggatagccccaaggaagcttgataacaactttggtgagaatccttatgaaaatcatgaggcggtgccgagtggcaattggtggctccaaattcaaggtgtgtacataggttattggcctggctccatttttacaacactgtctgatcactctacaagaataacctggggtggggagattggcacttctacaccacatggtcgtcacacacaaactgaaatgggccgtggccatttccctcatgaaggctatggaaaagcgagttatttttaccatgttcagtatgcggaccaacctggctctttcaaagatgctacaagtctcatcccttacgcaacaaagcctttatgttatgatataattgtttttcctcctagggaaggtacttcttatggaactagtttcttttatggaggtcctggatactccagttcttgtcaaacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Neprosin Neprosin_AP

Protein Analysis

193

Amino Acids

21.7

Weight (kDa)

6.14

Isoelectric Point (pI)

24.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 132
AccB1I GGYRCC 1 cut(s) 199
AciI CCGC 2 cut(s) 197, 422
AcoI YGGCCR 1 cut(s) 364
AcsI RAATTY 1 cut(s) 225
AfaI GTAC 2 cut(s) 239, 520
AfiI CCNNNNNNNGG 4 cut(s) 111, 306, 380, 515
AgsI TTSAA 5 cut(s) 15, 62, 73, 230, 442
AhlI ACTAGT 1 cut(s) 533
AjnI CCWGG 4 cut(s) 253, 299, 430, 553
AluBI AGCT 2 cut(s) 55, 154
AluI AGCT 2 cut(s) 55, 154
Alw26I GTCTC 1 cut(s) 461
AoxI GGCC 4 cut(s) 113, 251, 358, 364
ApoI RAATTY 1 cut(s) 225
AspA2I CCTAGG 1 cut(s) 509
AspS9I GGNCC 3 cut(s) 358, 424, 551
AsuHPI GGTGA 1 cut(s) 182
AvaII GGWCC 2 cut(s) 424, 551
AvrII CCTAGG 1 cut(s) 509
BaeI ACNNNNGTAYC 1 cut(s) 550
BalI TGGCCA 1 cut(s) 366
BanI GGYRCC 1 cut(s) 199
BccI CCATC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 345
BciT130I CCWGG 4 cut(s) 255, 301, 432, 555
BciVI GTATCC 1 cut(s) 551
BclI TGATCA 1 cut(s) 280
BcoDI GTCTC 1 cut(s) 461
BcuI ACTAGT 1 cut(s) 533
BfaI CTAG 2 cut(s) 510, 534
BfuI GTATCC 1 cut(s) 551
BlnI CCTAGG 1 cut(s) 509
Bme1390I CCNGG 4 cut(s) 255, 301, 432, 555
Bme18I GGWCC 2 cut(s) 424, 551
BmgT120I GGNCC 3 cut(s) 358, 424, 551
BmiI GGNNCC 4 cut(s) 6, 201, 221, 259
BmrFI CCNGG 4 cut(s) 255, 301, 432, 555
BmrI ACTGGG 1 cut(s) 3
BmsI GCATC 1 cut(s) 436
BmuI ACTGGG 1 cut(s) 3
BpmI CTGGAG 1 cut(s) 547
BsaBI GATNNNNATC 1 cut(s) 104
BsaJI CCNNGG 4 cut(s) 146, 300, 361, 509
Bsc4I CCNNNNNNNGG 4 cut(s) 111, 306, 380, 515
Bse1I ACTGG 2 cut(s) 9, 564
Bse8I GATNNNNATC 1 cut(s) 104
BseBI CCWGG 4 cut(s) 255, 301, 432, 555
BseDI CCNNGG 4 cut(s) 146, 300, 361, 509
BseGI GGATG 1 cut(s) 459
BseJI GATNNNNATC 1 cut(s) 104
BseLI CCNNNNNNNGG 4 cut(s) 111, 306, 380, 515
BseNI ACTGG 2 cut(s) 9, 564
BshFI GGCC 4 cut(s) 115, 253, 360, 366
BshNI GGYRCC 1 cut(s) 199
BslI CCNNNNNNNGG 4 cut(s) 111, 306, 380, 515
BsmAI GTCTC 1 cut(s) 461
BsmI GAATGC 1 cut(s) 89
BsnI GGCC 4 cut(s) 115, 253, 360, 366
Bsp1407I TGTACA 1 cut(s) 237
Bsp143I GATC 1 cut(s) 280
BspACI CCGC 2 cut(s) 197, 422
BspANI GGCC 4 cut(s) 115, 253, 360, 366
BspHI TCATGA 2 cut(s) 190, 376
BspLI GGNNCC 4 cut(s) 6, 201, 221, 259
BspT107I GGYRCC 1 cut(s) 199
BsrGI TGTACA 1 cut(s) 237
BsrI ACTGG 2 cut(s) 9, 564
BssECI CCNNGG 4 cut(s) 146, 300, 361, 509
BssMI GATC 1 cut(s) 280
BssT1I CCWWGG 2 cut(s) 146, 509
Bst2UI CCWGG 4 cut(s) 255, 301, 432, 555
Bst4CI ACNGT 1 cut(s) 276
BstAUI TGTACA 1 cut(s) 237
BstDSI CCRYGG 1 cut(s) 361
BstENI CCTNNNNNAGG 2 cut(s) 378, 513
BstF5I GGATG 1 cut(s) 459
BstKTI GATC 1 cut(s) 283
BstMAI GTCTC 1 cut(s) 461
BstMBI GATC 1 cut(s) 280
BstNI CCWGG 4 cut(s) 255, 301, 432, 555
BstSCI CCNGG 4 cut(s) 253, 299, 430, 553
BsuI GTATCC 1 cut(s) 551
BsuRI GGCC 4 cut(s) 115, 253, 360, 366
BtgI CCRYGG 1 cut(s) 361
BtsCI GGATG 1 cut(s) 459
BtsIMutI CAGTG 1 cut(s) 272
CciI TCATGA 2 cut(s) 190, 376
Cfr13I GGNCC 3 cut(s) 358, 424, 551
Csp6I GTAC 2 cut(s) 238, 519
CviAII CATG 4 cut(s) 191, 332, 377, 410
CviQI GTAC 2 cut(s) 238, 519
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
EaeI YGGCCR 1 cut(s) 364
Eco130I CCWWGG 2 cut(s) 146, 509
Eco47I GGWCC 2 cut(s) 424, 551
EcoNI CCTNNNNNAGG 2 cut(s) 378, 513
EcoO109I RGGNCCY 1 cut(s) 551
EcoRII CCWGG 4 cut(s) 253, 299, 430, 553
EcoT14I CCWWGG 2 cut(s) 146, 509
ErhI CCWWGG 2 cut(s) 146, 509
FaeI CATG 4 cut(s) 194, 335, 380, 413
FalI AAGNNNNNCTT 2 cut(s) 39, 71
FatI CATG 4 cut(s) 190, 331, 376, 409
FbaI TGATCA 1 cut(s) 280
FokI GGATG 1 cut(s) 446
FspBI CTAG 2 cut(s) 510, 534
GsuI CTGGAG 1 cut(s) 547
HaeIII GGCC 4 cut(s) 115, 253, 360, 366
Hin1II CATG 4 cut(s) 194, 335, 380, 413
HindIII AAGCTT 2 cut(s) 53, 152
HinfI GANTC 2 cut(s) 100, 175
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 280
Hpy188III TCNNGA 4 cut(s) 62, 73, 191, 377
Hpy8I GTNNAC 1 cut(s) 238
HpyAV CCTTC 2 cut(s) 374, 509
HpyCH4III ACNGT 1 cut(s) 276
Hsp92II CATG 4 cut(s) 194, 335, 380, 413
Ksp22I TGATCA 1 cut(s) 280
Kzo9I GATC 1 cut(s) 280
LmnI GCTCC 2 cut(s) 225, 263
LweI GCATC 1 cut(s) 436
MaeI CTAG 2 cut(s) 510, 534
MaeIII GTNAC 1 cut(s) 338
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MfeI CAATTG 1 cut(s) 211
MlsI TGGCCA 1 cut(s) 366
MluCI AATT 4 cut(s) 133, 211, 225, 495
MluNI TGGCCA 1 cut(s) 366
MnlI CCTC 4 cut(s) 187, 384, 516, 542
Mox20I TGGCCA 1 cut(s) 366
MscI TGGCCA 1 cut(s) 366
Msp20I TGGCCA 1 cut(s) 366
MspR9I CCNGG 4 cut(s) 255, 301, 432, 555
MunI CAATTG 1 cut(s) 211
Mva1269I GAATGC 1 cut(s) 89
MvaI CCWGG 4 cut(s) 255, 301, 432, 555
NdeII GATC 1 cut(s) 280
NlaIII CATG 4 cut(s) 194, 335, 380, 413
NlaIV GGNNCC 4 cut(s) 6, 201, 221, 259
NmeAIII GCCGAG 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 338
PagI TCATGA 2 cut(s) 190, 376
PctI GAATGC 1 cut(s) 89
PfeI GAWTC 2 cut(s) 100, 175
PfoI TCCNGGA 1 cut(s) 553
PpuMI RGGWCCY 1 cut(s) 551
PsiI TTATAA 1 cut(s) 132
Psp5II RGGWCCY 1 cut(s) 551
Psp6I CCWGG 4 cut(s) 253, 299, 430, 553
PspGI CCWGG 4 cut(s) 253, 299, 430, 553
PspN4I GGNNCC 4 cut(s) 6, 201, 221, 259
PspPI GGNCC 3 cut(s) 358, 424, 551
PspPPI RGGWCCY 1 cut(s) 551
RsaI GTAC 2 cut(s) 239, 520
RsaNI GTAC 2 cut(s) 238, 519
Sau3AI GATC 1 cut(s) 280
Sau96I GGNCC 3 cut(s) 358, 424, 551
ScrFI CCNGG 4 cut(s) 255, 301, 432, 555
SetI ASST 8 cut(s) 57, 156, 235, 247, 302, 433, 520, 553
SfaNI GCATC 1 cut(s) 436
SinI GGWCC 2 cut(s) 424, 551
SpeI ACTAGT 1 cut(s) 533
Sse9I AATT 4 cut(s) 133, 211, 225, 495
SsiI CCGC 2 cut(s) 197, 422
SspMI CTAG 2 cut(s) 510, 534
StyD4I CCNGG 4 cut(s) 253, 299, 430, 553
StyI CCWWGG 2 cut(s) 146, 509
TaaI ACNGT 1 cut(s) 276
TasI AATT 4 cut(s) 133, 211, 225, 495
TatI WGTACW 1 cut(s) 237
TfiI GAWTC 2 cut(s) 100, 175
TscAI CASTG 1 cut(s) 279
TseFI GTSAC 1 cut(s) 338
Tsp45I GTSAC 1 cut(s) 338
TspDTI ATGAA 2 cut(s) 198, 393
TspGWI ACGGA 1 cut(s) 108
TspRI CASTG 1 cut(s) 279
VpaK11BI GGWCC 2 cut(s) 424, 551
XagI CCTNNNNNAGG 2 cut(s) 378, 513
XapI RAATTY 1 cut(s) 225
XmaJI CCTAGG 1 cut(s) 509
XspI CTAG 2 cut(s) 510, 534
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.