Rh2CG408700

Neprosin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0004413
Physical Location & Seq
Reverse (-)
55526191 .. 55526575
385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG408700.1

Sequence Viewer

Length: 348 bp
ATGCCTCAAAGTACTAGCAAATGGGGGCTTAAAGTGCAAAATGAGGTATTAGGTTACTGGATTACTTGGGGTGGGGAGATTACTGATTCAAGAACAGGTGGTCGTCAAACATCGACTCAAATGGAGAATGGTCATTTTCCTCATGAAGGCTACGGCAAAGCGAGCTATTTTGGCACCCTTCAGTACGCAGACAACGATAAAAACTTCAAAGATGTTCCTGTTGAAAGTCTTGAAACATATGCCACAAAGCCTAGATGCTACAATGTAGTCCTTATGAATAGAATTTCAATCTATGAAACCCATTTCTATTTTGGAGGTCCTGGGTATTCACCAAGCTGTCCTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Neprosin Neprosin_AP

Protein Analysis

115

Amino Acids

13.03

Weight (kDa)

6.26

Isoelectric Point (pI)

33.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Neprosin PF03080 21 - 107 7.7e-20 Neprosin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 173
AcsI RAATTY 1 cut(s) 282
AcuI CTGAAG 1 cut(s) 164
AfaI GTAC 2 cut(s) 13, 185
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 5 cut(s) 90, 208, 224, 233, 288
AjnI CCWGG 1 cut(s) 319
AluBI AGCT 2 cut(s) 165, 336
AluI AGCT 2 cut(s) 165, 336
ApoI RAATTY 1 cut(s) 282
AspS9I GGNCC 1 cut(s) 317
AsuHPI GGTGA 1 cut(s) 321
AvaII GGWCC 1 cut(s) 317
BanI GGYRCC 1 cut(s) 173
BceAI ACGGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 321
BfaI CTAG 2 cut(s) 15, 252
BmcAI AGTACT 1 cut(s) 13
Bme1390I CCNGG 1 cut(s) 321
Bme18I GGWCC 1 cut(s) 317
BmgT120I GGNCC 1 cut(s) 317
BmiI GGNNCC 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 321
BmsI GCATC 1 cut(s) 245
BsaJI CCNNGG 1 cut(s) 320
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 321
BseDI CCNNGG 1 cut(s) 320
BseLI CCNNNNNNNGG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 62
BshNI GGYRCC 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 146
BspHI TCATGA 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 175
BspT107I GGYRCC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 320
Bst2UI CCWGG 1 cut(s) 321
BstC8I GCNNGC 1 cut(s) 163
BstENI CCTNNNNNAGG 1 cut(s) 144
BstMWI GCNNNNNNNGC 3 cut(s) 34, 162, 171
BstNI CCWGG 1 cut(s) 321
BstSCI CCNGG 1 cut(s) 319
Cac8I GCNNGC 1 cut(s) 163
CciI TCATGA 1 cut(s) 142
Cfr13I GGNCC 1 cut(s) 317
Csp6I GTAC 2 cut(s) 12, 184
CviAII CATG 1 cut(s) 143
CviJI RGCY 5 cut(s) 28, 150, 165, 250, 336
CviKI_1 RGCY 5 cut(s) 28, 150, 165, 250, 336
CviQI GTAC 2 cut(s) 12, 184
Eco47I GGWCC 1 cut(s) 317
Eco57I CTGAAG 1 cut(s) 164
EcoNI CCTNNNNNAGG 1 cut(s) 144
EcoO109I RGGNCCY 1 cut(s) 317
EcoRII CCWGG 1 cut(s) 319
FaeI CATG 1 cut(s) 146
FaiI YATR 5 cut(s) 144, 238, 240, 275, 294
FatI CATG 1 cut(s) 142
FauNDI CATATG 1 cut(s) 238
FspBI CTAG 2 cut(s) 15, 252
Hin1II CATG 1 cut(s) 146
HinfI GANTC 2 cut(s) 86, 115
HphI GGTGA 1 cut(s) 321
Hpy188III TCNNGA 3 cut(s) 90, 143, 230
HpyAV CCTTC 2 cut(s) 140, 188
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 3 cut(s) 34, 162, 171
Hsp92II CATG 1 cut(s) 146
LpnPI CCDG 5 cut(s) 43, 81, 231, 306, 333
LweI GCATC 1 cut(s) 245
MaeI CTAG 2 cut(s) 15, 252
MaeIII GTNAC 1 cut(s) 53
MluCI AATT 2 cut(s) 282, 343
MlyI GAGTC 1 cut(s) 109
MnlI CCTC 4 cut(s) 15, 37, 150, 308
MseI TTAA 1 cut(s) 30
MspR9I CCNGG 1 cut(s) 321
MvaI CCWGG 1 cut(s) 321
MwoI GCNNNNNNNGC 3 cut(s) 34, 162, 171
NdeI CATATG 1 cut(s) 238
NlaIII CATG 1 cut(s) 146
NlaIV GGNNCC 1 cut(s) 175
PagI TCATGA 1 cut(s) 142
PcsI WCGNNNNNNNCGW 1 cut(s) 192
PfeI GAWTC 1 cut(s) 86
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 317
Psp5II RGGWCCY 1 cut(s) 317
Psp6I CCWGG 1 cut(s) 319
PspGI CCWGG 1 cut(s) 319
PspN4I GGNNCC 1 cut(s) 175
PspPI GGNCC 1 cut(s) 317
PspPPI RGGWCCY 1 cut(s) 317
RsaI GTAC 2 cut(s) 13, 185
RsaNI GTAC 2 cut(s) 12, 184
SaqAI TTAA 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 317
ScaI AGTACT 1 cut(s) 13
SchI GAGTC 1 cut(s) 109
ScrFI CCNGG 1 cut(s) 321
SetI ASST 6 cut(s) 48, 55, 100, 167, 319, 338
SfaNI GCATC 1 cut(s) 245
SinI GGWCC 1 cut(s) 317
Sse9I AATT 2 cut(s) 282, 343
SspMI CTAG 2 cut(s) 15, 252
StyD4I CCNGG 1 cut(s) 319
TaqI TCGA 1 cut(s) 113
TasI AATT 2 cut(s) 282, 343
TatI WGTACW 1 cut(s) 11
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TspDTI ATGAA 3 cut(s) 159, 290, 309
VpaK11BI GGWCC 1 cut(s) 317
XagI CCTNNNNNAGG 1 cut(s) 144
XapI RAATTY 1 cut(s) 282
XcmI CCANNNNNNNNNTGG 1 cut(s) 308
XspI CTAG 2 cut(s) 15, 252
ZrmI AGTACT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.