RchiOBHm_Chr2g0147571

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002408
Physical Location & Seq
Forward (+)
65129315 .. 65129546
232 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51717

Sequence Viewer

Length: 195 bp
ATGCTTGGTGATGTAGTAAATACCCCATATTGTTGGAGGTATGTACAGTTGCCTATTTTACTATGGACACCCAAGAATTTTATCTTGGTACCCAGTCTTCTTCTTCGATTGCACCCAACAGCCAAGCAATCAACTGCTAGGCAAAGCCCTGCTTCGGCTGAAGAAACACCGCCAGGAGCTTCCTCCAAGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.09

Weight (kDa)

9.51

Isoelectric Point (pI)

66.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 88
AccB1I GGYRCC 1 cut(s) 88
AciI CCGC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 76
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 2 cut(s) 45, 90
AfiI CCNNNNNNNGG 1 cut(s) 154
AjnI CCWGG 1 cut(s) 172
AjuI GAANNNNNNNTTGG 2 cut(s) 68, 100
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
ApoI RAATTY 1 cut(s) 76
Asp718I GGTACC 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 20
BanI GGYRCC 1 cut(s) 88
BarI GAAGNNNNNNTAC 2 cut(s) 81, 113
BbsI GAAGAC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 174
BfaI CTAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 174
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 174
BmrI ACTGGG 1 cut(s) 87
BmuI ACTGGG 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 174
BseLI CCNNNNNNNGG 1 cut(s) 154
BseNI ACTGG 1 cut(s) 93
BshNI GGYRCC 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 154
Bsp1407I TGTACA 1 cut(s) 43
BspACI CCGC 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 90
BspT107I GGYRCC 1 cut(s) 88
BsrGI TGTACA 1 cut(s) 43
BsrI ACTGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 48
BstAUI TGTACA 1 cut(s) 43
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BstV2I GAAGAC 1 cut(s) 89
BstXI CCANNNNNNTGG 1 cut(s) 33
Csp6I GTAC 2 cut(s) 44, 89
CviJI RGCY 5 cut(s) 122, 147, 158, 179, 190
CviKI_1 RGCY 5 cut(s) 122, 147, 158, 179, 190
CviQI GTAC 2 cut(s) 44, 89
Eco57I CTGAAG 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 172
FaiI YATR 3 cut(s) 28, 42, 64
FalI AAGNNNNNCTT 2 cut(s) 136, 168
FspBI CTAG 1 cut(s) 138
HphI GGTGA 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 112
KpnI GGTACC 1 cut(s) 92
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 4 cut(s) 106, 159, 162, 186
MaeI CTAG 1 cut(s) 138
MboII GAAGA 4 cut(s) 89, 92, 95, 173
MluCI AATT 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 14
MnlI CCTC 2 cut(s) 30, 193
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NlaIV GGNNCC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspN4I GGNNCC 1 cut(s) 90
RsaI GTAC 2 cut(s) 45, 90
RsaNI GTAC 2 cut(s) 44, 89
ScrFI CCNGG 1 cut(s) 174
SetI ASST 2 cut(s) 41, 181
SgeI CNNG 9 cut(s) 17, 85, 97, 105, 136, 150, 161, 185, 186
Sse9I AATT 1 cut(s) 76
SsiI CCGC 1 cut(s) 170
SspMI CTAG 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 106
TasI AATT 1 cut(s) 76
TatI WGTACW 1 cut(s) 43
XapI RAATTY 1 cut(s) 76
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.