RchiOBHm_Chr2g0172691

UPF0586 protein C9orf41 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0003309
Physical Location & Seq
Reverse (-)
85990767 .. 85991726
960 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53996

Sequence Viewer

Length: 225 bp
ATGCATAAAGTTTCTCATCCTATATGCAGTTGTCAAACTGCTGGAGAGCAGACACTATATCCGTGGATCCACAGCAATTGTAATTCACTTTCAGATGACGACCAACTTTGTCCCTTTTCAGTGCCAGATATTCATCCCGCTAGTGCAGGGATTACTGAAGGCTTTTCTATGTGTGGCGGTGACTTTGTTGAGGTTTATAACAATATATCCAAGCCAAGTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00340 map00340
Pfam Domains
Protein Families
N2227

Protein Analysis

74

Amino Acids

8.07

Weight (kDa)

4.94

Isoelectric Point (pI)

48.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CARME PF07942 10 - 68 1.2e-15 Carnosine N-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 198
AciI CCGC 2 cut(s) 138, 177
AclWI GGATC 2 cut(s) 61, 74
AcuI CTGAAG 1 cut(s) 177
AlwI GGATC 2 cut(s) 61, 74
AsuHPI GGTGA 1 cut(s) 191
BamHI GGATCC 1 cut(s) 66
BfaI CTAG 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 68
BpmI CTGGAG 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 62
Bse8I GATNNNNATC 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 62
BseGI GGATG 2 cut(s) 16, 133
BseJI GATNNNNATC 1 cut(s) 132
BsgI GTGCAG 1 cut(s) 165
BslFI GGGAC 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 66
BspACI CCGC 2 cut(s) 138, 177
BspLI GGNNCC 1 cut(s) 68
BspPI GGATC 2 cut(s) 61, 74
BssECI CCNNGG 1 cut(s) 62
BssMI GATC 1 cut(s) 66
BstDSI CCRYGG 1 cut(s) 62
BstF5I GGATG 2 cut(s) 16, 133
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstX2I RGATCY 1 cut(s) 66
BstYI RGATCY 1 cut(s) 66
BtgI CCRYGG 1 cut(s) 62
BtsCI GGATG 2 cut(s) 16, 133
BtsIMutI CAGTG 1 cut(s) 126
CspCI CAANNNNNGTGG 2 cut(s) 59, 94
CviJI RGCY 2 cut(s) 162, 214
CviKI_1 RGCY 2 cut(s) 162, 214
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 7 cut(s) 6, 23, 25, 58, 170, 198, 206
FaqI GGGAC 1 cut(s) 96
FauI CCCGC 1 cut(s) 145
FokI GGATG 2 cut(s) 3, 120
FspBI CTAG 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 63
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 4, 27, 146
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 27, 132, 138
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 179
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MfeI CAATTG 1 cut(s) 76
MflI RGATCY 1 cut(s) 66
MluCI AATT 2 cut(s) 76, 82
MnlI CCTC 1 cut(s) 184
Mph1103I ATGCAT 1 cut(s) 6
MunI CAATTG 1 cut(s) 76
NdeII GATC 1 cut(s) 66
NlaIV GGNNCC 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 179
NsiI ATGCAT 1 cut(s) 6
PsiI TTATAA 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 68
PsuI RGATCY 1 cut(s) 66
Sau3AI GATC 1 cut(s) 66
SetI ASST 2 cut(s) 195, 224
SgeI CNNG 6 cut(s) 54, 75, 137, 149, 153, 159
Sse9I AATT 2 cut(s) 76, 82
SsiI CCGC 2 cut(s) 138, 177
SspMI CTAG 1 cut(s) 141
TasI AATT 2 cut(s) 76, 82
TscAI CASTG 1 cut(s) 126
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 122
TspGWI ACGGA 1 cut(s) 51
TspRI CASTG 1 cut(s) 126
XspI CTAG 1 cut(s) 141
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.