RchiOBHm_Chr5g0059521

N2227

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
64474728 .. 64478529
3802 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33612

Sequence Viewer

Length: 141 bp
ATGATGACCAAACTTCGTCCCGTTTCAATACCAGATATTCATCCCGCTAGTGCAGGGATTACTGAAGGCTTTTCTATGTGTGGCGGTGACTTTGTTGAGGTTTATAATGATCCAAGCCAAGTAGGAACATATATGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

4.96

Weight (kDa)

4.43

Isoelectric Point (pI)

37.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CARME PF07942 4 - 38 2.4e-07 Carnosine N-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 105
AciI CCGC 2 cut(s) 45, 84
AclWI GGATC 1 cut(s) 104
AcuI CTGAAG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 27
AlwI GGATC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 98
BfaI CTAG 1 cut(s) 48
BsaBI GATNNNNATC 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 39
BseGI GGATG 1 cut(s) 40
BseJI GATNNNNATC 1 cut(s) 39
BsgI GTGCAG 1 cut(s) 72
BslFI GGGAC 1 cut(s) 3
BsmFI GGGAC 1 cut(s) 3
Bsp143I GATC 1 cut(s) 109
BspACI CCGC 2 cut(s) 45, 84
BspPI GGATC 1 cut(s) 104
BssMI GATC 1 cut(s) 109
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BtsCI GGATG 1 cut(s) 40
CviJI RGCY 2 cut(s) 69, 117
CviKI_1 RGCY 2 cut(s) 69, 117
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco57I CTGAAG 1 cut(s) 84
FaiI YATR 5 cut(s) 77, 105, 130, 132, 134
FaqI GGGAC 1 cut(s) 3
FauI CCCGC 1 cut(s) 52
FokI GGATG 1 cut(s) 27
FspBI CTAG 1 cut(s) 48
HphI GGTGA 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 53
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 2 cut(s) 39, 45
MaeI CTAG 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MnlI CCTC 1 cut(s) 91
NdeII GATC 1 cut(s) 109
NmuCI GTSAC 1 cut(s) 86
PsiI TTATAA 1 cut(s) 105
Sau3AI GATC 1 cut(s) 109
SetI ASST 1 cut(s) 102
SgeI CNNG 7 cut(s) 32, 44, 56, 60, 66, 126, 131
SsiI CCGC 2 cut(s) 45, 84
SspMI CTAG 1 cut(s) 48
TseFI GTSAC 1 cut(s) 86
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 29
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.