RchiOBHm_Chr3g0485871

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
32642941 .. 32646236
3296 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45044

Sequence Viewer

Length: 144 bp
ATGGTGGAGGAGGGAGATGCAATTGAAAATCAGAGAAAGAAAGATAAGAAGAAGCTTGAAGTAGAGAAATCAAAGAAGATGCTAGCTTCTGCAATTATTTGGGTTAATCATTTCTTCTCAATCTACTATGGAATGAGGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.55

Weight (kDa)

9.4

Isoelectric Point (pI)

21.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 26, 59
AluBI AGCT 2 cut(s) 55, 86
AluI AGCT 2 cut(s) 55, 86
AsuNHI GCTAGC 1 cut(s) 82
BfaI CTAG 1 cut(s) 83
BmsI GCATC 2 cut(s) 7, 69
BmtI GCTAGC 1 cut(s) 86
BseRI GAGGAG 1 cut(s) 23
BspOI GCTAGC 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 84
CviJI RGCY 2 cut(s) 55, 86
CviKI_1 RGCY 2 cut(s) 55, 86
FaiI YATR 1 cut(s) 129
FspBI CTAG 1 cut(s) 83
FspEI CC 6 cut(s) 85, 86, 114, 121, 122, 123
HindIII AAGCTT 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 33
HpyCH4V TGCA 2 cut(s) 20, 92
LweI GCATC 2 cut(s) 7, 69
MaeI CTAG 1 cut(s) 83
MboII GAAGA 3 cut(s) 61, 88, 106
MfeI CAATTG 1 cut(s) 21
MluCI AATT 2 cut(s) 21, 93
MnlI CCTC 2 cut(s) 4, 129
MseI TTAA 1 cut(s) 105
MunI CAATTG 1 cut(s) 21
NheI GCTAGC 1 cut(s) 82
SaqAI TTAA 1 cut(s) 105
SetI ASST 2 cut(s) 57, 88
SfaNI GCATC 2 cut(s) 7, 69
SgeI CNNG 2 cut(s) 68, 95
Sse9I AATT 2 cut(s) 21, 93
SspMI CTAG 1 cut(s) 83
TasI AATT 2 cut(s) 21, 93
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.