Rh7BG306900

pleiotropic drug resistance protein 3-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
29404712 .. 29405461
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG306900.1

Sequence Viewer

Length: 312 bp
ATGACAGACTACATAATAAAGATCCTTGGGCTAGACATTTGTGCTGAGACAATCGTAGGAGATCCAATGCAAAGAGGAATTTCGGGTGGCCAAAAGAAAAGACTAACAACAGGTAATTTTGCTGTATCCGACACGGCCAATAGTTTGCTGTCTGCAACCATGAAATACTTTGGATATCACCCTGCATTGACACTTGATGAGGTCAAGGAGCGGGTACCACTAGCAAGGAACACAAAAAACATCGGCAAAGATCAAGCAAGGTCGCATGTTTCTTCAGATTGTACTCTCAAGTACATAATAGAACACCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

103

Amino Acids

11.34

Weight (kDa)

8.6

Isoelectric Point (pI)

23.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 214
AccB1I GGYRCC 1 cut(s) 214
AccBSI CCGCTC 1 cut(s) 211
AciI CCGC 1 cut(s) 211
AclWI GGATC 2 cut(s) 16, 56
AcoI YGGCCR 2 cut(s) 88, 135
AcsI RAATTY 1 cut(s) 78
AcuI CTGAAG 1 cut(s) 258
AfaI GTAC 3 cut(s) 216, 283, 293
Alw26I GTCTC 1 cut(s) 41
AlwI GGATC 2 cut(s) 16, 56
AoxI GGCC 2 cut(s) 88, 135
ApoI RAATTY 1 cut(s) 78
Asp718I GGTACC 1 cut(s) 214
AsuHPI GGTGA 1 cut(s) 170
BalI TGGCCA 1 cut(s) 90
BanI GGYRCC 1 cut(s) 214
BceAI ACGGC 1 cut(s) 150
BciVI GTATCC 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 2 cut(s) 32, 221
BfuI GTATCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 272
BsaJI CCNNGG 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 36
BshFI GGCC 2 cut(s) 90, 137
BshNI GGYRCC 1 cut(s) 214
BsmAI GTCTC 1 cut(s) 41
BsnI GGCC 2 cut(s) 90, 137
Bsp143I GATC 3 cut(s) 21, 61, 250
BspACI CCGC 1 cut(s) 211
BspANI GGCC 2 cut(s) 90, 137
BspCNI CTCAG 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 216
BspPI GGATC 2 cut(s) 16, 56
BspT107I GGYRCC 1 cut(s) 214
BsrBI CCGCTC 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 3 cut(s) 21, 61, 250
BssT1I CCWWGG 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 45
BstKTI GATC 3 cut(s) 24, 64, 253
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 3 cut(s) 21, 61, 250
BstNSI RCATGY 1 cut(s) 269
BstX2I RGATCY 2 cut(s) 21, 61
BstYI RGATCY 2 cut(s) 21, 61
BsuI GTATCC 1 cut(s) 136
BsuRI GGCC 2 cut(s) 90, 137
Csp6I GTAC 3 cut(s) 215, 282, 292
CviAII CATG 2 cut(s) 160, 266
CviJI RGCY 3 cut(s) 31, 90, 137
CviKI_1 RGCY 3 cut(s) 31, 90, 137
CviQI GTAC 3 cut(s) 215, 282, 292
DdeI CTNAG 1 cut(s) 45
DpnI GATC 3 cut(s) 23, 63, 252
DpnII GATC 3 cut(s) 21, 61, 250
EaeI YGGCCR 2 cut(s) 88, 135
Eco130I CCWWGG 1 cut(s) 25
Eco32I GATATC 1 cut(s) 176
Eco57I CTGAAG 1 cut(s) 258
EcoRV GATATC 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 25
ErhI CCWWGG 1 cut(s) 25
FaeI CATG 2 cut(s) 163, 269
FaiI YATR 5 cut(s) 14, 161, 267, 296, 310
FatI CATG 2 cut(s) 159, 265
FauI CCCGC 1 cut(s) 204
FspBI CTAG 2 cut(s) 32, 221
HaeIII GGCC 2 cut(s) 90, 137
Hin1II CATG 2 cut(s) 163, 269
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 130, 277
HpyCH4V TGCA 3 cut(s) 70, 155, 185
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 2 cut(s) 163, 269
KpnI GGTACC 1 cut(s) 218
Kzo9I GATC 3 cut(s) 21, 61, 250
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 2 cut(s) 96, 195
MaeI CTAG 2 cut(s) 32, 221
MalI GATC 3 cut(s) 23, 63, 252
MbiI CCGCTC 1 cut(s) 211
MboI GATC 3 cut(s) 21, 61, 250
MboII GAAGA 1 cut(s) 264
MflI RGATCY 2 cut(s) 21, 61
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 2 cut(s) 78, 115
MluNI TGGCCA 1 cut(s) 90
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 68, 193
Mox20I TGGCCA 1 cut(s) 90
MscI TGGCCA 1 cut(s) 90
Msp20I TGGCCA 1 cut(s) 90
NdeII GATC 3 cut(s) 21, 61, 250
NlaIII CATG 2 cut(s) 163, 269
NlaIV GGNNCC 1 cut(s) 216
NspI RCATGY 1 cut(s) 269
PspN4I GGNNCC 1 cut(s) 216
PsuI RGATCY 2 cut(s) 21, 61
RsaI GTAC 3 cut(s) 216, 283, 293
RsaNI GTAC 3 cut(s) 215, 282, 292
Sau3AI GATC 3 cut(s) 21, 61, 250
SetI ASST 3 cut(s) 115, 204, 263
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
Sse9I AATT 2 cut(s) 78, 115
SsiI CCGC 1 cut(s) 211
SspMI CTAG 2 cut(s) 32, 221
StyI CCWWGG 1 cut(s) 25
TasI AATT 2 cut(s) 78, 115
TatI WGTACW 2 cut(s) 281, 291
TspDTI ATGAA 1 cut(s) 176
XapI RAATTY 1 cut(s) 78
XceI RCATGY 1 cut(s) 269
XspI CTAG 2 cut(s) 32, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.