Rroxscaffold_4G00328540

Belongs to the aldehyde dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
61582646 .. 61586117
3472 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00328540.1

Sequence Viewer

Length: 210 bp
ATGGAGAGATTTCTCTTACAACAACACCCACTTGGAAAAGCTCAAGCTCATTTATTGTTGGACGATGGGAATCAGAGCCAGGAGAACAGTTTCATATATGGACCTCCAAGGGGAAGGACAACGCAATCAGAGACCAAGGTTCAGTGCTATGAACCTGCAATCATGAAATACTTGGGATATTACCCTGCATTGACACCTGATGAGGTCTAG

Protein Analysis

69

Amino Acids

7.88

Weight (kDa)

5.5

Isoelectric Point (pI)

37.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 163
AfiI CCNNNNNNNGG 1 cut(s) 110
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 2 cut(s) 41, 47
AluI AGCT 2 cut(s) 41, 47
Alw26I GTCTC 1 cut(s) 125
Asp700I GAANNNNTTC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 101
AvaII GGWCC 1 cut(s) 101
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 208
BfuAI ACCTGC 1 cut(s) 163
Bme1390I CCNGG 1 cut(s) 80
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 27
BsaBI GATNNNNATC 1 cut(s) 69
BsaI GGTCTC 1 cut(s) 125
BsaJI CCNNGG 2 cut(s) 107, 135
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse8I GATNNNNATC 1 cut(s) 69
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 2 cut(s) 107, 135
BseJI GATNNNNATC 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 125
Bso31I GGTCTC 1 cut(s) 125
BspHI TCATGA 1 cut(s) 162
BspMI ACCTGC 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 125
BssECI CCNNGG 2 cut(s) 107, 135
BssT1I CCWWGG 2 cut(s) 107, 135
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 125
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 149
BveI ACCTGC 1 cut(s) 163
CciI TCATGA 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 101
CviAII CATG 1 cut(s) 163
CviJI RGCY 3 cut(s) 41, 47, 78
CviKI_1 RGCY 3 cut(s) 41, 47, 78
Eco130I CCWWGG 2 cut(s) 107, 135
Eco31I GGTCTC 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 2 cut(s) 107, 135
ErhI CCWWGG 2 cut(s) 107, 135
FaeI CATG 1 cut(s) 166
FaiI YATR 5 cut(s) 95, 97, 99, 150, 164
FatI CATG 1 cut(s) 162
FspBI CTAG 1 cut(s) 208
Hin1II CATG 1 cut(s) 166
HinfI GANTC 1 cut(s) 70
Hpy188I TCNGA 2 cut(s) 75, 130
Hpy188III TCNNGA 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4V TGCA 2 cut(s) 158, 188
Hsp92II CATG 1 cut(s) 166
LpnPI CCDG 4 cut(s) 65, 92, 168, 198
MaeI CTAG 1 cut(s) 208
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 2 cut(s) 114, 196
MroXI GAANNNNTTC 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
NlaIII CATG 1 cut(s) 166
PagI TCATGA 1 cut(s) 162
PdmI GAANNNNTTC 1 cut(s) 89
PfeI GAWTC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 101
Sau96I GGNCC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 80
SetI ASST 7 cut(s) 43, 49, 106, 141, 157, 199, 207
SinI GGWCC 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 42
SmoI CTYRAG 1 cut(s) 42
SspMI CTAG 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 2 cut(s) 107, 135
TaaI ACNGT 1 cut(s) 89
TfiI GAWTC 1 cut(s) 70
TscAI CASTG 1 cut(s) 149
TspDTI ATGAA 3 cut(s) 82, 165, 179
TspRI CASTG 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 101
XmnI GAANNNNTTC 1 cut(s) 89
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.