RchiOBHm_Chr4g0432331

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
56482087 .. 56482685
599 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40095

Sequence Viewer

Length: 357 bp
ATGGGTCGTCGTCTAATTGCCGCAACTATCCTCACCTTCACCTTGTTCACCATCGTCATCCTTCCCTCCGCGGCCAAGGGAGAAGGCAAAGGTAACAGCTTACATGTCGGGTTTTACGCTTCGAGTTGCCCCAAGGTTGAGGACATTGTTGCTGAGGTTGTGGCCCGTGTTCATGAGCAAGATCCCAAGCTCCCTCCTGCCCTCCTCCGCCTTTTTTTCCATGATTGCTTTGTCAAGGGTTGTGATGCCTCGATCTTGTTGGACGCGACACCATCTGGTGAGCCTATAGAGAAAACATCACCAGCCAATGGTGAAACACTCAGAGGTCTTGAGGTTGTTGATGAGATCAAAGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.63

Weight (kDa)

5.55

Isoelectric Point (pI)

50.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 50 - 118 4.7e-17 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 308
AccII CGCG 2 cut(s) 71, 266
AciI CCGC 4 cut(s) 21, 69, 71, 208
AclWI GGATC 1 cut(s) 176
AcoI YGGCCR 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 308
AflIII ACRYGT 1 cut(s) 103
AluBI AGCT 2 cut(s) 99, 190
AluI AGCT 2 cut(s) 99, 190
AlwI GGATC 1 cut(s) 176
AoxI GGCC 2 cut(s) 72, 162
AspS9I GGNCC 1 cut(s) 163
AsuHPI GGTGA 6 cut(s) 25, 31, 40, 290, 291, 323
BbvCI CCTCAGC 1 cut(s) 153
BccI CCATC 2 cut(s) 59, 280
BfaI CTAG 1 cut(s) 355
BfmI CTRYAG 1 cut(s) 285
BisI GCNGC 2 cut(s) 21, 72
BlsI GCNGC 2 cut(s) 22, 73
BmgT120I GGNCC 1 cut(s) 163
BmsI GCATC 1 cut(s) 235
Bpu10I CCTNAGC 1 cut(s) 153
BpuEI CTTGAG 1 cut(s) 350
BsaJI CCNNGG 3 cut(s) 69, 75, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 308
BseDI CCNNGG 3 cut(s) 69, 75, 132
BseGI GGATG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 308
BseMII CTCAG 2 cut(s) 144, 334
BseRI GAGGAG 1 cut(s) 194
Bsh1236I CGCG 2 cut(s) 71, 266
BshFI GGCC 2 cut(s) 74, 164
BslI CCNNNNNNNGG 1 cut(s) 308
BsnI GGCC 2 cut(s) 74, 164
Bsp143I GATC 3 cut(s) 181, 252, 345
BspACI CCGC 4 cut(s) 21, 69, 71, 208
BspANI GGCC 2 cut(s) 74, 164
BspCNI CTCAG 2 cut(s) 145, 333
BspFNI CGCG 2 cut(s) 71, 266
BspHI TCATGA 1 cut(s) 172
BspPI GGATC 1 cut(s) 176
BssECI CCNNGG 3 cut(s) 69, 75, 132
BssMI GATC 3 cut(s) 181, 252, 345
BssT1I CCWWGG 2 cut(s) 75, 132
BstDEI CTNAG 2 cut(s) 153, 320
BstDSI CCRYGG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 57
BstFNI CGCG 2 cut(s) 71, 266
BstKTI GATC 3 cut(s) 184, 255, 348
BstMBI GATC 3 cut(s) 181, 252, 345
BstNSI RCATGY 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 285
BstUI CGCG 2 cut(s) 71, 266
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BsuRI GGCC 2 cut(s) 74, 164
BtgI CCRYGG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 57
CciI TCATGA 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 163
Cfr42I CCGCGG 1 cut(s) 72
CseI GACGC 1 cut(s) 272
CviAII CATG 3 cut(s) 104, 173, 221
CviJI RGCY 7 cut(s) 74, 99, 164, 190, 283, 305, 353
CviKI_1 RGCY 7 cut(s) 74, 99, 164, 190, 283, 305, 353
DdeI CTNAG 2 cut(s) 153, 320
DpnI GATC 3 cut(s) 183, 254, 347
DpnII GATC 3 cut(s) 181, 252, 345
EaeI YGGCCR 1 cut(s) 72
EciI GGCGGA 1 cut(s) 197
Eco130I CCWWGG 2 cut(s) 75, 132
EcoT14I CCWWGG 2 cut(s) 75, 132
ErhI CCWWGG 2 cut(s) 75, 132
FaeI CATG 3 cut(s) 107, 176, 224
FaiI YATR 4 cut(s) 105, 174, 222, 287
FatI CATG 3 cut(s) 103, 172, 220
Fnu4HI GCNGC 2 cut(s) 21, 72
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 2 cut(s) 21, 72
FspBI CTAG 1 cut(s) 355
GluI GCNGC 2 cut(s) 21, 72
HaeIII GGCC 2 cut(s) 74, 164
HgaI GACGC 1 cut(s) 272
Hin1II CATG 3 cut(s) 107, 176, 224
HphI GGTGA 6 cut(s) 25, 31, 40, 290, 291, 323
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 323
Hpy188III TCNNGA 2 cut(s) 173, 329
Hpy8I GTNNAC 1 cut(s) 48
Hpy99I CGWCG 1 cut(s) 12
HpyAV CCTTC 3 cut(s) 46, 71, 77
HpyF3I CTNAG 2 cut(s) 153, 320
Hsp92II CATG 3 cut(s) 107, 176, 224
KspI CCGCGG 1 cut(s) 72
Kzo9I GATC 3 cut(s) 181, 252, 345
LmnI GCTCC 1 cut(s) 195
LpnPI CCDG 3 cut(s) 210, 261, 315
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 355
MaeIII GTNAC 1 cut(s) 92
MalI GATC 3 cut(s) 183, 254, 347
MboI GATC 3 cut(s) 181, 252, 345
MflI RGATCY 1 cut(s) 181
MluCI AATT 1 cut(s) 15
MmeI TCCRAC 1 cut(s) 240
MspA1I CMGCKG 1 cut(s) 71
MvnI CGCG 2 cut(s) 71, 266
NdeII GATC 3 cut(s) 181, 252, 345
NlaIII CATG 3 cut(s) 107, 176, 224
NspI RCATGY 1 cut(s) 107
PagI TCATGA 1 cut(s) 172
PciI ACATGT 1 cut(s) 103
PflMI CCANNNNNTGG 1 cut(s) 308
PkrI GCNGC 2 cut(s) 22, 73
PscI ACATGT 1 cut(s) 103
PspPI GGNCC 1 cut(s) 163
PsuI RGATCY 1 cut(s) 181
SacII CCGCGG 1 cut(s) 72
SatI GCNGC 2 cut(s) 21, 72
Sau3AI GATC 3 cut(s) 181, 252, 345
Sau96I GGNCC 1 cut(s) 163
SetI ASST 9 cut(s) 38, 44, 94, 101, 138, 159, 192, 328, 336
SfaNI GCATC 1 cut(s) 235
SfcI CTRYAG 1 cut(s) 285
Sfr303I CCGCGG 1 cut(s) 72
SgrBI CCGCGG 1 cut(s) 72
SmlI CTYRAG 1 cut(s) 329
SmoI CTYRAG 1 cut(s) 329
Sse9I AATT 1 cut(s) 15
SsiI CCGC 4 cut(s) 21, 69, 71, 208
SspMI CTAG 1 cut(s) 355
StyI CCWWGG 2 cut(s) 75, 132
TaqI TCGA 2 cut(s) 122, 251
TasI AATT 1 cut(s) 15
TauI GCSGC 2 cut(s) 23, 74
TspDTI ATGAA 1 cut(s) 161
Van91I CCANNNNNTGG 1 cut(s) 308
XceI RCATGY 1 cut(s) 107
XspI CTAG 1 cut(s) 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.