Rh4DG316400

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
53916185 .. 53917057
873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG316400.1

Sequence Viewer

Length: 399 bp
ATGTTCGCCAAAAGAGGCTTGACAACAGAAGATATGGTTGTCTTGTCCGGTGTACACTCCATTGGCGAAACACAATGCACCCAAATTGAAGACAGATTATACAAATATAGCAAAGCTCAGCCCCAAGACCCTTCCCTGGACCCAACCTATGCTGATGAGCTAGCCGGAAAGTGCCTAGCACCAGACACATTACCTGCGGAGCAAGCATTACGTACAATGGTGGACTTTGATCCAACAACACCACTTGACCTCGACAATCAGTACTATGTGAACCTGATGAGAGGGAGAGGCTTGCTTCAATCGGATCAAGTACTGACTACTGATCCCCAAACCGGAGCAATTGTGTACAGAATGGCCGCTAGCTCTGAAACTTGGAGTAAAATTTTTTTCAAGGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.71

Weight (kDa)

4.62

Isoelectric Point (pI)

33.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 1 - 120 2.7e-33 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 202
AciI CCGC 2 cut(s) 197, 357
AclWI GGATC 3 cut(s) 224, 312, 317
AcoI YGGCCR 1 cut(s) 354
AcsI RAATTY 1 cut(s) 381
AfaI GTAC 5 cut(s) 54, 214, 263, 312, 347
AfiI CCNNNNNNNGG 2 cut(s) 136, 332
AgsI TTSAA 3 cut(s) 89, 299, 391
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 3 cut(s) 116, 160, 363
AluI AGCT 3 cut(s) 116, 160, 363
AlwI GGATC 3 cut(s) 224, 312, 317
AoxI GGCC 1 cut(s) 354
ApoI RAATTY 1 cut(s) 381
AspS9I GGNCC 1 cut(s) 139
AsuNHI GCTAGC 2 cut(s) 160, 359
AvaII GGWCC 1 cut(s) 139
BbsI GAAGAC 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 3 cut(s) 161, 176, 360
BfuAI ACCTGC 1 cut(s) 202
BisI GCNGC 1 cut(s) 357
BlpI GCTNAGC 1 cut(s) 117
BlsI GCNGC 1 cut(s) 358
BmcAI AGTACT 2 cut(s) 263, 312
Bme1390I CCNGG 1 cut(s) 137
Bme18I GGWCC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 139
BmiI GGNNCC 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 137
BmtI GCTAGC 2 cut(s) 164, 363
BpiI GAAGAC 1 cut(s) 96
Bpu1102I GCTNAGC 1 cut(s) 117
BsaAI YACGTR 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 135
BsaWI WCCGGW 2 cut(s) 47, 332
BsaXI ACNNNNNCTCC 2 cut(s) 327, 357
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 332
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 136, 332
BseMII CTCAG 1 cut(s) 131
BshFI GGCC 1 cut(s) 356
BsiSI CCGG 3 cut(s) 48, 165, 333
BslI CCNNNNNNNGG 2 cut(s) 136, 332
BsnI GGCC 1 cut(s) 356
Bsp1407I TGTACA 2 cut(s) 52, 345
Bsp143I GATC 3 cut(s) 229, 304, 322
Bsp1720I GCTNAGC 1 cut(s) 117
BspACI CCGC 2 cut(s) 197, 357
BspANI GGCC 1 cut(s) 356
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 141
BspMI ACCTGC 1 cut(s) 202
BspOI GCTAGC 2 cut(s) 164, 363
BspPI GGATC 3 cut(s) 224, 312, 317
BsrGI TGTACA 2 cut(s) 52, 345
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 3 cut(s) 229, 304, 322
Bst2UI CCWGG 1 cut(s) 137
BstAUI TGTACA 2 cut(s) 52, 345
BstBAI YACGTR 1 cut(s) 212
BstC8I GCNNGC 4 cut(s) 162, 204, 293, 361
BstDEI CTNAG 1 cut(s) 117
BstKTI GATC 3 cut(s) 232, 307, 325
BstMBI GATC 3 cut(s) 229, 304, 322
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstSNI TACGTA 1 cut(s) 212
BstV2I GAAGAC 1 cut(s) 96
BsuRI GGCC 1 cut(s) 356
BveI ACCTGC 1 cut(s) 202
Cac8I GCNNGC 4 cut(s) 162, 204, 293, 361
Cfr13I GGNCC 1 cut(s) 139
Csp6I GTAC 5 cut(s) 53, 213, 262, 311, 346
CviAII CATG 1 cut(s) 396
CviJI RGCY 8 cut(s) 18, 116, 121, 160, 164, 291, 356, 363
CviKI_1 RGCY 8 cut(s) 18, 116, 121, 160, 164, 291, 356, 363
CviQI GTAC 5 cut(s) 53, 213, 262, 311, 346
DdeI CTNAG 1 cut(s) 117
DpnI GATC 3 cut(s) 231, 306, 324
DpnII GATC 3 cut(s) 229, 304, 322
EaeI YGGCCR 1 cut(s) 354
Eco105I TACGTA 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 135
FaeI CATG 1 cut(s) 399
FaiI YATR 6 cut(s) 35, 100, 108, 150, 267, 397
FatI CATG 1 cut(s) 395
Fnu4HI GCNGC 1 cut(s) 357
Fsp4HI GCNGC 1 cut(s) 357
FspBI CTAG 3 cut(s) 161, 176, 360
GluI GCNGC 1 cut(s) 357
HaeIII GGCC 1 cut(s) 356
HapII CCGG 3 cut(s) 48, 165, 333
Hin1II CATG 1 cut(s) 399
HpaII CCGG 3 cut(s) 48, 165, 333
Hpy166II GTNNAC 5 cut(s) 53, 55, 223, 271, 346
Hpy188I TCNGA 2 cut(s) 304, 367
Hpy8I GTNNAC 5 cut(s) 53, 55, 223, 271, 346
HpyAV CCTTC 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 211
HpyCH4V TGCA 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 1 cut(s) 399
Kzo9I GATC 3 cut(s) 229, 304, 322
LmnI GCTCC 2 cut(s) 199, 335
LpnPI CCDG 8 cut(s) 61, 122, 149, 178, 195, 207, 287, 346
MaeI CTAG 3 cut(s) 161, 176, 360
MaeII ACGT 1 cut(s) 211
MalI GATC 3 cut(s) 231, 306, 324
MboI GATC 3 cut(s) 229, 304, 322
MboII GAAGA 2 cut(s) 41, 101
MfeI CAATTG 1 cut(s) 339
MluCI AATT 3 cut(s) 84, 339, 381
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 4 cut(s) 8, 260, 275, 281
MspI CCGG 3 cut(s) 48, 165, 333
MspR9I CCNGG 1 cut(s) 137
MunI CAATTG 1 cut(s) 339
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 3 cut(s) 229, 304, 322
NheI GCTAGC 2 cut(s) 160, 359
NlaIII CATG 1 cut(s) 399
NlaIV GGNNCC 1 cut(s) 141
PkrI GCNGC 1 cut(s) 358
Ppu21I YACGTR 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 141
PspPI GGNCC 1 cut(s) 139
RsaI GTAC 5 cut(s) 54, 214, 263, 312, 347
RsaNI GTAC 5 cut(s) 53, 213, 262, 311, 346
SatI GCNGC 1 cut(s) 357
Sau3AI GATC 3 cut(s) 229, 304, 322
Sau96I GGNCC 1 cut(s) 139
ScaI AGTACT 2 cut(s) 263, 312
ScrFI CCNGG 1 cut(s) 137
SetI ASST 8 cut(s) 118, 149, 162, 196, 214, 252, 276, 365
SinI GGWCC 1 cut(s) 139
SnaBI TACGTA 1 cut(s) 212
Sse9I AATT 3 cut(s) 84, 339, 381
SsiI CCGC 2 cut(s) 197, 357
SspMI CTAG 3 cut(s) 161, 176, 360
StyD4I CCNGG 1 cut(s) 135
TaiI ACGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 252
TasI AATT 3 cut(s) 84, 339, 381
TatI WGTACW 4 cut(s) 52, 261, 310, 345
TauI GCSGC 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 139
XapI RAATTY 1 cut(s) 381
XspI CTAG 3 cut(s) 161, 176, 360
ZrmI AGTACT 2 cut(s) 263, 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.