Rmu_co8257897.1_g000001

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8257897.1
Physical Location & Seq
Reverse (-)
1 .. 260
260 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8257897.1_g000001.1.cds

Sequence Viewer

Length: 238 bp
atgggtcgtcgtctaattgccgcaactatcctcaccttcaccttgttcaccatcgtcatccttccctccgaggccaagggagaaggcaaagggaacggcttacatgtcgggttttacgcttcgagttgccccaaggttgaggacactgttgctgaggttgtggcccgtgttcatgagcaagatcccaagctccctcctgccctcctccgcctttttttccatgattggctttgtcaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.72

Weight (kDa)

6.81

Isoelectric Point (pI)

51.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 21, 208
AclWI GGATC 1 cut(s) 176
AflIII ACRYGT 1 cut(s) 103
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 1 cut(s) 176
AoxI GGCC 2 cut(s) 72, 162
AspS9I GGNCC 1 cut(s) 163
AsuHPI GGTGA 3 cut(s) 25, 31, 40
BbvCI CCTCAGC 1 cut(s) 153
BccI CCATC 1 cut(s) 59
BceAI ACGGC 1 cut(s) 112
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 163
Bpu10I CCTNAGC 1 cut(s) 153
BsaJI CCNNGG 3 cut(s) 69, 75, 132
BseDI CCNNGG 3 cut(s) 69, 75, 132
BseGI GGATG 1 cut(s) 57
BseMII CTCAG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 194
BshFI GGCC 2 cut(s) 74, 164
BsnI GGCC 2 cut(s) 74, 164
Bsp143I GATC 1 cut(s) 181
BspACI CCGC 2 cut(s) 21, 208
BspANI GGCC 2 cut(s) 74, 164
BspCNI CTCAG 1 cut(s) 145
BspHI TCATGA 1 cut(s) 172
BspPI GGATC 1 cut(s) 176
BssECI CCNNGG 3 cut(s) 69, 75, 132
BssMI GATC 1 cut(s) 181
BssT1I CCWWGG 2 cut(s) 75, 132
Bst4CI ACNGT 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 153
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstNSI RCATGY 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BsuRI GGCC 2 cut(s) 74, 164
BtsCI GGATG 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 144
CciI TCATGA 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 163
CviAII CATG 3 cut(s) 104, 173, 221
CviJI RGCY 5 cut(s) 74, 99, 164, 190, 229
CviKI_1 RGCY 5 cut(s) 74, 99, 164, 190, 229
DdeI CTNAG 1 cut(s) 153
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
EciI GGCGGA 1 cut(s) 197
Eco130I CCWWGG 2 cut(s) 75, 132
EcoT14I CCWWGG 2 cut(s) 75, 132
ErhI CCWWGG 2 cut(s) 75, 132
FaeI CATG 3 cut(s) 107, 176, 224
FaiI YATR 3 cut(s) 105, 174, 222
FatI CATG 3 cut(s) 103, 172, 220
Fnu4HI GCNGC 1 cut(s) 21
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 21
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 2 cut(s) 74, 164
Hin1II CATG 3 cut(s) 107, 176, 224
HphI GGTGA 3 cut(s) 25, 31, 40
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 48
Hpy99I CGWCG 1 cut(s) 12
HpyAV CCTTC 3 cut(s) 46, 71, 77
HpyCH4III ACNGT 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 153
Hsp92II CATG 3 cut(s) 107, 176, 224
Kzo9I GATC 1 cut(s) 181
LmnI GCTCC 1 cut(s) 195
LpnPI CCDG 1 cut(s) 210
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MflI RGATCY 1 cut(s) 181
MluCI AATT 1 cut(s) 15
MnlI CCTC 8 cut(s) 41, 64, 76, 133, 148, 204, 212, 215
NdeII GATC 1 cut(s) 181
NlaIII CATG 3 cut(s) 107, 176, 224
NspI RCATGY 1 cut(s) 107
PagI TCATGA 1 cut(s) 172
PciI ACATGT 1 cut(s) 103
PkrI GCNGC 1 cut(s) 22
PscI ACATGT 1 cut(s) 103
PspPI GGNCC 1 cut(s) 163
PsuI RGATCY 1 cut(s) 181
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 1 cut(s) 181
Sau96I GGNCC 1 cut(s) 163
SetI ASST 5 cut(s) 38, 44, 138, 159, 192
Sse9I AATT 1 cut(s) 15
SsiI CCGC 2 cut(s) 21, 208
StyI CCWWGG 2 cut(s) 75, 132
TaaI ACNGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 122
TasI AATT 1 cut(s) 15
TauI GCSGC 1 cut(s) 23
TscAI CASTG 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 161
TspRI CASTG 1 cut(s) 151
XceI RCATGY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.