RchiOBHm_Chr4g0445751

ribose-5-phosphate isomerase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
66170631 .. 66172135
1505 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41333

Sequence Viewer

Length: 207 bp
ATGATCTTTGGCCTTGGCTCCAACTCCACCATCAAACACCCTGTGGATCGCTTGGGCGAGCTTTTACAACCGGGAAAAGTTCACAACATCATCGGAATTTCCGAGAACACCCACCAACAAGTCATTGATAGGAGCATATTTATGCAACGTTTTCCGAAGCAAATTAGGAAAAGAAGGCTTAAAGAAGGAAAGTGCGTGGAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.87

Weight (kDa)

10.28

Isoelectric Point (pI)

43.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 148
AclWI GGATC 1 cut(s) 54
AcsI RAATTY 2 cut(s) 96, 200
AdeI CACNNNGTG 1 cut(s) 43
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
AlwI GGATC 1 cut(s) 54
AoxI GGCC 1 cut(s) 10
ApoI RAATTY 2 cut(s) 96, 200
AsuC2I CCSGG 1 cut(s) 72
BccI CCATC 1 cut(s) 38
BcnI CCSGG 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 72
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 72
BpuMI CCSGG 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 13
BseDI CCNNGG 1 cut(s) 13
BshFI GGCC 1 cut(s) 12
BsiSI CCGG 1 cut(s) 71
BsnI GGCC 1 cut(s) 12
Bsp143I GATC 2 cut(s) 3, 46
BspANI GGCC 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 19
BspPI GGATC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 2 cut(s) 3, 46
BssT1I CCWWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 59
BstKTI GATC 2 cut(s) 6, 49
BstMBI GATC 2 cut(s) 3, 46
BstSCI CCNGG 1 cut(s) 70
BsuRI GGCC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 59
CviJI RGCY 4 cut(s) 12, 18, 61, 178
CviKI_1 RGCY 4 cut(s) 12, 18, 61, 178
DpnI GATC 2 cut(s) 5, 48
DpnII GATC 2 cut(s) 3, 46
DraIII CACNNNGTG 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
FaiI YATR 2 cut(s) 137, 143
HaeIII GGCC 1 cut(s) 12
HapII CCGG 1 cut(s) 71
HpaII CCGG 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 3 cut(s) 95, 103, 156
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 2 cut(s) 168, 179
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 145
HpySE526I ACGT 1 cut(s) 148
Kzo9I GATC 2 cut(s) 3, 46
LmnI GCTCC 2 cut(s) 23, 132
LpnPI CCDG 2 cut(s) 54, 84
MaeII ACGT 1 cut(s) 148
MalI GATC 2 cut(s) 5, 48
MboI GATC 2 cut(s) 3, 46
MluCI AATT 3 cut(s) 96, 162, 200
MmeI TCCRAC 1 cut(s) 45
MseI TTAA 1 cut(s) 180
MslI CAYNNNNRTG 1 cut(s) 140
MspI CCGG 1 cut(s) 71
MspR9I CCNGG 1 cut(s) 72
NciI CCSGG 1 cut(s) 72
NdeII GATC 2 cut(s) 3, 46
NlaIV GGNNCC 1 cut(s) 19
PcsI WCGNNNNNNNCGW 1 cut(s) 99
Psp1406I AACGTT 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 2 cut(s) 3, 46
ScrFI CCNGG 1 cut(s) 72
SetI ASST 2 cut(s) 63, 151
SgeI CNNG 8 cut(s) 26, 53, 64, 70, 83, 84, 115, 131
SmiMI CAYNNNNRTG 1 cut(s) 140
Sse9I AATT 3 cut(s) 96, 162, 200
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 13
TaiI ACGT 1 cut(s) 151
TasI AATT 3 cut(s) 96, 162, 200
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
XapI RAATTY 2 cut(s) 96, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.