Rh6AG276800

ribose-5-phosphate isomerase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
47080552 .. 47082493
1942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG276800.1

Sequence Viewer

Length: 363 bp
ATGGAGATATTGAGGGTTGCCAAGGCGACTAGCTCTGCCACATTAATGCCAACAATCTTGTACCAACTTCATTCCACAAACTCTTCAATTTTGACCCAAGACAAGTTGAAGAAAATCGCCTCCTACAAGGTTGTCGAGTCCGGCATGATCGTCGACCTCAGCTCCGGCTCCACCGTCAAACACACCGTGGATCGCTTGGGCGAGCTTTTACAACGGGGAAAAGTTCACAACATCATCGGAATTTCCGAGAACACCCACCAACAAGTCATCTCTCTTAGAATTCCATTATCCAACCTCGATGACTACCCGATCCTCGATCTCGCTATCGATGGTGCCGACGAGGTGGACCCCAACTCAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.1

Weight (kDa)

5.71

Isoelectric Point (pI)

27.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rib_5-P_isom_A PF06026 79 - 118 3e-08 Ribose 5-phosphate isomerase A (phosphoriboisomerase A)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 332
AccI GTMKAC 1 cut(s) 153
AclWI GGATC 2 cut(s) 198, 304
AcsI RAATTY 2 cut(s) 240, 279
AdeI CACNNNGTG 1 cut(s) 187
AfaI GTAC 1 cut(s) 62
AgsI TTSAA 2 cut(s) 87, 109
AluBI AGCT 3 cut(s) 33, 162, 205
AluI AGCT 3 cut(s) 33, 162, 205
AlwI GGATC 2 cut(s) 198, 304
ApoI RAATTY 2 cut(s) 240, 279
AseI ATTAAT 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 346
AvaII GGWCC 1 cut(s) 346
BanI GGYRCC 1 cut(s) 332
BbvCI CCTCAGC 1 cut(s) 158
BccI CCATC 1 cut(s) 323
BcgI CGANNNNNNTGC 2 cut(s) 133, 167
BfaI CTAG 2 cut(s) 30, 361
Bme18I GGWCC 1 cut(s) 346
BmgT120I GGNCC 1 cut(s) 346
BmiI GGNNCC 3 cut(s) 169, 334, 348
Bpu10I CCTNAGC 1 cut(s) 158
Bsa29I ATCGAT 1 cut(s) 327
BsaJI CCNNGG 2 cut(s) 21, 186
BsaXI ACNNNNNCTCC 2 cut(s) 146, 176
BseCI ATCGAT 1 cut(s) 327
BseDI CCNNGG 2 cut(s) 21, 186
BseMII CTCAG 1 cut(s) 172
BshNI GGYRCC 1 cut(s) 332
BshVI ATCGAT 1 cut(s) 327
BsiSI CCGG 2 cut(s) 141, 165
Bsp143I GATC 4 cut(s) 147, 190, 309, 316
BspCNI CTCAG 1 cut(s) 171
BspDI ATCGAT 1 cut(s) 327
BspLI GGNNCC 3 cut(s) 169, 334, 348
BspPI GGATC 2 cut(s) 198, 304
BspT107I GGYRCC 1 cut(s) 332
BssECI CCNNGG 2 cut(s) 21, 186
BssMI GATC 4 cut(s) 147, 190, 309, 316
BssT1I CCWWGG 1 cut(s) 21
Bst4CI ACNGT 2 cut(s) 175, 187
Bst6I CTCTTC 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 203
BstDEI CTNAG 2 cut(s) 158, 275
BstDSI CCRYGG 1 cut(s) 186
BstKTI GATC 4 cut(s) 150, 193, 312, 319
BstMBI GATC 4 cut(s) 147, 190, 309, 316
Bsu15I ATCGAT 1 cut(s) 327
BsuTUI ATCGAT 1 cut(s) 327
BtgI CCRYGG 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 346
ClaI ATCGAT 1 cut(s) 327
Csp6I GTAC 1 cut(s) 61
CviAII CATG 1 cut(s) 145
CviJI RGCY 4 cut(s) 33, 162, 168, 205
CviKI_1 RGCY 4 cut(s) 33, 162, 168, 205
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 2 cut(s) 158, 275
DpnI GATC 4 cut(s) 149, 192, 311, 318
DpnII GATC 4 cut(s) 147, 190, 309, 316
DraIII CACNNNGTG 1 cut(s) 187
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 346
EcoRI GAATTC 1 cut(s) 279
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 1 cut(s) 148
FaiI YATR 1 cut(s) 146
FatI CATG 1 cut(s) 144
FblI GTMKAC 1 cut(s) 153
FspBI CTAG 2 cut(s) 30, 361
HapII CCGG 2 cut(s) 141, 165
Hin1II CATG 1 cut(s) 148
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HinfI GANTC 1 cut(s) 137
HpaII CCGG 2 cut(s) 141, 165
Hpy166II GTNNAC 3 cut(s) 154, 226, 346
Hpy188I TCNGA 2 cut(s) 239, 247
Hpy8I GTNNAC 3 cut(s) 154, 226, 346
Hpy99I CGWCG 2 cut(s) 155, 341
HpyCH4III ACNGT 2 cut(s) 175, 187
HpyF3I CTNAG 2 cut(s) 158, 275
Hsp92II CATG 1 cut(s) 148
Kzo9I GATC 4 cut(s) 147, 190, 309, 316
LmnI GCTCC 2 cut(s) 167, 173
LpnPI CCDG 2 cut(s) 154, 178
MaeI CTAG 2 cut(s) 30, 361
MalI GATC 4 cut(s) 149, 192, 311, 318
MboI GATC 4 cut(s) 147, 190, 309, 316
MboII GAAGA 2 cut(s) 75, 121
MluCI AATT 3 cut(s) 87, 240, 279
MlyI GAGTC 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 315
MnlI CCTC 6 cut(s) 6, 130, 167, 305, 323, 334
MseI TTAA 1 cut(s) 44
MslI CAYNNNNRTG 1 cut(s) 44
MspI CCGG 2 cut(s) 141, 165
NdeII GATC 4 cut(s) 147, 190, 309, 316
NlaIII CATG 1 cut(s) 148
NlaIV GGNNCC 3 cut(s) 169, 334, 348
PcsI WCGNNNNNNNCGW 2 cut(s) 243, 333
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 44
PspN4I GGNNCC 3 cut(s) 169, 334, 348
PspPI GGNCC 1 cut(s) 346
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 44
SalI GTCGAC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 44
Sau3AI GATC 4 cut(s) 147, 190, 309, 316
Sau96I GGNCC 1 cut(s) 346
SchI GAGTC 1 cut(s) 146
SetI ASST 8 cut(s) 35, 132, 159, 164, 207, 297, 345, 362
SinI GGWCC 1 cut(s) 346
SmiMI CAYNNNNRTG 1 cut(s) 44
Sse9I AATT 3 cut(s) 87, 240, 279
SspMI CTAG 2 cut(s) 30, 361
StyI CCWWGG 1 cut(s) 21
TaaI ACNGT 2 cut(s) 175, 187
TaqI TCGA 5 cut(s) 135, 153, 297, 315, 327
TasI AATT 3 cut(s) 87, 240, 279
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 346
VspI ATTAAT 1 cut(s) 44
XapI RAATTY 2 cut(s) 240, 279
XmiI GTMKAC 1 cut(s) 153
XspI CTAG 2 cut(s) 30, 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.