Rh7CG419800

ribose-5-phosphate isomerase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0003704
Physical Location & Seq
Forward (+)
54158037 .. 54158255
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG419800.1

Sequence Viewer

Length: 219 bp
ATGATCGTCGACCTCGGCTCCGGCTCCACTGTCAAACACGCCGTGGATAGCTTGGGCGAGCTTTTACAACTGGGAAAAGTTCACAACATCATCGGAATTTCCGAGAACACCCAGCAACAAGTCATCTCTCTTAGAATTCCATTCTCCAACCTCGATGACTACCCGATCCTCAATCTCGCTATCGACGGTGCCGATGAGGTGGACCCCACCTCAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00030 ko00710 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00030 map00710 map01100 map01110 map01120 map01130 map01200 map01230
Pfam Domains
Protein Families
Rib_5-P_isom_A

Protein Analysis

72

Amino Acids

7.69

Weight (kDa)

4.2

Isoelectric Point (pI)

25.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rib_5-P_isom_A PF06026 31 - 70 2.5e-07 Ribose 5-phosphate isomerase A (phosphoriboisomerase A)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 188
AccI GTMKAC 1 cut(s) 9
AclWI GGATC 1 cut(s) 160
AcsI RAATTY 2 cut(s) 96, 135
AdeI CACNNNGTG 1 cut(s) 43
AluBI AGCT 2 cut(s) 51, 61
AluI AGCT 2 cut(s) 51, 61
AlwI GGATC 1 cut(s) 160
ApoI RAATTY 2 cut(s) 96, 135
AspS9I GGNCC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 202
BanI GGYRCC 1 cut(s) 188
BceAI ACGGC 1 cut(s) 26
BfaI CTAG 1 cut(s) 217
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmiI GGNNCC 4 cut(s) 19, 25, 190, 204
BmrI ACTGGG 1 cut(s) 80
BmuI ACTGGG 1 cut(s) 80
BsaJI CCNNGG 2 cut(s) 13, 42
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 13, 42
BseNI ACTGG 1 cut(s) 75
BseYI CCCAGC 1 cut(s) 111
BshNI GGYRCC 1 cut(s) 188
BsiSI CCGG 1 cut(s) 21
Bsp143I GATC 2 cut(s) 3, 165
BspLI GGNNCC 4 cut(s) 19, 25, 190, 204
BspPI GGATC 1 cut(s) 160
BspT107I GGYRCC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 75
BssECI CCNNGG 2 cut(s) 13, 42
BssMI GATC 2 cut(s) 3, 165
Bst4CI ACNGT 2 cut(s) 31, 188
BstC8I GCNNGC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 131
BstDSI CCRYGG 1 cut(s) 42
BstKTI GATC 2 cut(s) 6, 168
BstMBI GATC 2 cut(s) 3, 165
BtgI CCRYGG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 202
CviJI RGCY 4 cut(s) 18, 24, 51, 61
CviKI_1 RGCY 4 cut(s) 18, 24, 51, 61
DdeI CTNAG 1 cut(s) 131
DpnI GATC 2 cut(s) 5, 167
DpnII GATC 2 cut(s) 3, 165
DraIII CACNNNGTG 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 202
EcoRI GAATTC 1 cut(s) 135
FblI GTMKAC 1 cut(s) 9
FspBI CTAG 1 cut(s) 217
GsaI CCCAGC 1 cut(s) 115
HapII CCGG 1 cut(s) 21
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
HpaII CCGG 1 cut(s) 21
Hpy166II GTNNAC 3 cut(s) 10, 82, 202
Hpy188I TCNGA 2 cut(s) 95, 103
Hpy8I GTNNAC 3 cut(s) 10, 82, 202
Hpy99I CGWCG 2 cut(s) 11, 188
HpyCH4III ACNGT 2 cut(s) 31, 188
HpyF3I CTNAG 1 cut(s) 131
Kzo9I GATC 2 cut(s) 3, 165
LmnI GCTCC 2 cut(s) 23, 29
LpnPI CCDG 3 cut(s) 34, 56, 125
MaeI CTAG 1 cut(s) 217
MalI GATC 2 cut(s) 5, 167
MboI GATC 2 cut(s) 3, 165
MluCI AATT 2 cut(s) 96, 135
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 4 cut(s) 23, 161, 179, 190
MspI CCGG 1 cut(s) 21
NdeII GATC 2 cut(s) 3, 165
NlaIV GGNNCC 4 cut(s) 19, 25, 190, 204
PcsI WCGNNNNNNNCGW 2 cut(s) 99, 189
PspFI CCCAGC 1 cut(s) 111
PspN4I GGNNCC 4 cut(s) 19, 25, 190, 204
PspPI GGNCC 1 cut(s) 202
SalI GTCGAC 1 cut(s) 8
Sau3AI GATC 2 cut(s) 3, 165
Sau96I GGNCC 1 cut(s) 202
SetI ASST 7 cut(s) 15, 53, 63, 153, 201, 212, 218
SinI GGWCC 1 cut(s) 202
Sse9I AATT 2 cut(s) 96, 135
SspMI CTAG 1 cut(s) 217
TaaI ACNGT 2 cut(s) 31, 188
TaqI TCGA 3 cut(s) 9, 153, 183
TasI AATT 2 cut(s) 96, 135
TscAI CASTG 1 cut(s) 34
TspRI CASTG 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 202
XapI RAATTY 2 cut(s) 96, 135
XmiI GTMKAC 1 cut(s) 9
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.