RLG00000016814

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
10294641 .. 10295383
743 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000016814

Sequence Viewer

Length: 378 bp
ATGTCTCAAAATCAGCAACTGATGAACGACTCCTGTTTCTCAATTCATGTGCCTGGAAGTAAGATTGTTGGCTTTCATGGCAGATCAAAGAGTAGGTGGTCGGGTGGTATGTATTCAATAGGAGCCTACGTAAAGCCTTATCATCAACAAATTGAATACCCTCCGACAAAAGCTCCGATGCTTTATCCATCAGAACCTCCACATCCATCTGAATTTCATTCTCCAACCAAGCTCAATAAAGATGACATACCTCAAGACCAGAAACATTACGCAGTTTCAAATATTCAAGTTAGCAGAAACGAGGGAGATTACAACGGAGCTTTCTATTTGGGCGACATGTATATATATACGAACTATTATATCGAAAAAGACGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.33

Weight (kDa)

6.57

Isoelectric Point (pI)

73.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 212
AflIII ACRYGT 1 cut(s) 336
AgsI TTSAA 4 cut(s) 117, 155, 279, 287
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 3 cut(s) 173, 232, 320
AluI AGCT 3 cut(s) 173, 232, 320
Alw26I GTCTC 1 cut(s) 9
AlwNI CAGNNNCTG 1 cut(s) 19
ApoI RAATTY 1 cut(s) 212
BccI CCATC 2 cut(s) 196, 214
BciT130I CCWGG 1 cut(s) 54
BcoDI GTCTC 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 54
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 237
BsaAI YACGTR 1 cut(s) 130
BsaXI ACNNNNNCTCC 4 cut(s) 114, 144, 157, 187
BseBI CCWGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 124
BssMI GATC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 54
BstBAI YACGTR 1 cut(s) 130
BstF5I GGATG 1 cut(s) 202
BstKTI GATC 1 cut(s) 86
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 83
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 54
BstNSI RCATGY 1 cut(s) 340
BstSCI CCNGG 1 cut(s) 52
BstSNI TACGTA 1 cut(s) 130
BtsCI GGATG 1 cut(s) 202
CaiI CAGNNNCTG 1 cut(s) 19
CviAII CATG 3 cut(s) 47, 77, 337
CviJI RGCY 6 cut(s) 72, 125, 136, 173, 232, 320
CviKI_1 RGCY 6 cut(s) 72, 125, 136, 173, 232, 320
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
Eco105I TACGTA 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 52
FaeI CATG 3 cut(s) 50, 80, 340
FatI CATG 3 cut(s) 46, 76, 336
FokI GGATG 1 cut(s) 189
Hin1II CATG 3 cut(s) 50, 80, 340
HinfI GANTC 1 cut(s) 29
Hpy188I TCNGA 4 cut(s) 165, 177, 193, 211
Hpy188III TCNNGA 1 cut(s) 254
HpyCH4IV ACGT 1 cut(s) 129
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 3 cut(s) 50, 80, 340
Kzo9I GATC 1 cut(s) 83
LmnI GCTCC 3 cut(s) 122, 178, 317
LpnPI CCDG 4 cut(s) 39, 46, 66, 272
LweI GCATC 1 cut(s) 168
MaeII ACGT 1 cut(s) 129
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MluCI AATT 3 cut(s) 42, 150, 212
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 2 cut(s) 188, 248
MnlI CCTC 4 cut(s) 171, 207, 261, 295
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 78
NdeII GATC 1 cut(s) 83
NlaIII CATG 3 cut(s) 50, 80, 340
NlaIV GGNNCC 1 cut(s) 124
NspI RCATGY 1 cut(s) 340
PciI ACATGT 1 cut(s) 336
PleI GAGTC 1 cut(s) 23
PpsI GAGTC 1 cut(s) 23
Ppu21I YACGTR 1 cut(s) 130
PscI ACATGT 1 cut(s) 336
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspN4I GGNNCC 1 cut(s) 124
PstNI CAGNNNCTG 1 cut(s) 19
Sau3AI GATC 1 cut(s) 83
SchI GAGTC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 54
SetI ASST 7 cut(s) 98, 132, 175, 199, 234, 253, 322
SfaNI GCATC 1 cut(s) 168
SmlI CTYRAG 1 cut(s) 252
SmoI CTYRAG 1 cut(s) 252
SnaBI TACGTA 1 cut(s) 130
Sse9I AATT 3 cut(s) 42, 150, 212
SspI AATATT 1 cut(s) 283
StyD4I CCNGG 1 cut(s) 52
TaiI ACGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 363
TasI AATT 3 cut(s) 42, 150, 212
TspDTI ATGAA 4 cut(s) 35, 38, 65, 206
TspGWI ACGGA 1 cut(s) 330
XapI RAATTY 1 cut(s) 212
XceI RCATGY 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.