Rroxscaffold_2G00079660

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
2637024 .. 2638221
1198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00079660.1

Sequence Viewer

Length: 183 bp
ATGCTTAATGGATGGTCTTCTGAAACCAAGCTCGAGAAAGATGATAGACCCCAAAACCAGAAACAGTACACAGTTAATGATATTCAAGTTAGCGGAAACAAGGGAAACTACAATGGAGCTTTCTATCTGGGTGACGTCACATATAACTGGTACATCGAAAAAGCACGCCTTGTGTCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.98

Weight (kDa)

7.96

Isoelectric Point (pI)

23.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 138
AciI CCGC 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 135
AfaI GTAC 2 cut(s) 68, 152
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 2 cut(s) 31, 119
AluI AGCT 2 cut(s) 31, 119
Ama87I CYCGRG 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 143
AvaI CYCGRG 1 cut(s) 32
BbsI GAAGAC 1 cut(s) 9
BccI CCATC 1 cut(s) 6
BmeT110I CYCGRG 1 cut(s) 32
BpiI GAAGAC 1 cut(s) 9
BsaHI GRCGYC 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 152
BsiHKCI CYCGRG 1 cut(s) 32
BsoBI CYCGRG 1 cut(s) 32
BspACI CCGC 1 cut(s) 93
BsrI ACTGG 1 cut(s) 152
BssNI GRCGYC 1 cut(s) 135
Bst4CI ACNGT 2 cut(s) 66, 73
BstACI GRCGYC 1 cut(s) 135
BstC8I GCNNGC 1 cut(s) 166
BstF5I GGATG 1 cut(s) 17
BstV2I GAAGAC 1 cut(s) 9
BtsCI GGATG 1 cut(s) 17
Cac8I GCNNGC 1 cut(s) 166
Csp6I GTAC 2 cut(s) 67, 151
CviJI RGCY 2 cut(s) 31, 119
CviKI_1 RGCY 2 cut(s) 31, 119
CviQI GTAC 2 cut(s) 67, 151
Eco88I CYCGRG 1 cut(s) 32
FaiI YATR 2 cut(s) 142, 144
FalI AAGNNNNNCTT 1 cut(s) 153
FokI GGATG 1 cut(s) 24
Hin1I GRCGYC 1 cut(s) 135
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 34
Hpy8I GTNNAC 1 cut(s) 69
HpyCH4III ACNGT 2 cut(s) 66, 73
HpyCH4IV ACGT 1 cut(s) 135
HpySE526I ACGT 1 cut(s) 135
Hsp92I GRCGYC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 71, 113, 133
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 2 cut(s) 131, 136
MboII GAAGA 1 cut(s) 9
MseI TTAA 2 cut(s) 6, 75
NmuCI GTSAC 2 cut(s) 131, 136
PaeR7I CTCGAG 1 cut(s) 32
RsaI GTAC 2 cut(s) 68, 152
RsaNI GTAC 2 cut(s) 67, 151
SaqAI TTAA 2 cut(s) 6, 75
SetI ASST 3 cut(s) 33, 121, 138
Sfr274I CTCGAG 1 cut(s) 32
SgeI CNNG 9 cut(s) 40, 44, 46, 70, 98, 112, 140, 160, 177
SlaI CTCGAG 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
SsiI CCGC 1 cut(s) 93
TaaI ACNGT 2 cut(s) 66, 73
TaiI ACGT 1 cut(s) 138
TaqI TCGA 2 cut(s) 33, 156
TatI WGTACW 1 cut(s) 66
Tru1I TTAA 2 cut(s) 6, 75
Tru9I TTAA 2 cut(s) 6, 75
TseFI GTSAC 2 cut(s) 131, 136
Tsp45I GTSAC 2 cut(s) 131, 136
XhoI CTCGAG 1 cut(s) 32
ZraI GACGTC 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.