RLG00000030723

cysteine-type peptidase activity

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
66492094 .. 66492630
537 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030723

Sequence Viewer

Length: 384 bp
ATGGCTTATGCAAAAAGCCTCGTGATCACCTCCACATTATTATTCATCATGTGGATGGGGATTTTGGAAACATCACAAGCCACATCCCGCAGATTCAAAGAGAACCCAAATTCCACCCTTTTCCTAGAATTTGAGCGATGGATGGTAGACTTCGACAAACATTACCCCAACGACGAAGAGAAGGAGAGGCGTTTCGCAATCTTCAAGAACAAGTTGGAGTGGGTCAGTGGGTCAAGAACTTCAACAAGCAAGGGAATCACTCTTTTACGCCGTGTTGATGTGTGGTACGGCTATGGAGCAGGGTTGGTTTGCTTGGAAGTCCGAGACTTGAGTATGGGGTACGTGAAGTTCACTCTTGTTCAATCTAGAAAAATTGTCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.92

Weight (kDa)

9.48

Isoelectric Point (pI)

42.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Inhibitor_I29 PF08246 44 - 74 9e-08 Cathepsin propeptide inhibitor domain (I29)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 147
AciI CCGC 1 cut(s) 88
AcsI RAATTY 2 cut(s) 109, 128
AfaI GTAC 2 cut(s) 287, 341
AgsI TTSAA 4 cut(s) 97, 205, 243, 362
AloI GAACNNNNNNTCC 2 cut(s) 95, 127
Alw26I GTCTC 1 cut(s) 318
ApoI RAATTY 2 cut(s) 109, 128
AsuHPI GGTGA 1 cut(s) 19
BauI CACGAG 1 cut(s) 20
BccI CCATC 3 cut(s) 49, 132, 136
BceAI ACGGC 2 cut(s) 255, 304
BclI TGATCA 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 318
BfaI CTAG 2 cut(s) 125, 366
BpuEI CTTGAG 1 cut(s) 349
BsaAI YACGTR 1 cut(s) 343
BseGI GGATG 3 cut(s) 60, 83, 147
BsmAI GTCTC 1 cut(s) 318
Bsp143I GATC 1 cut(s) 24
BspACI CCGC 1 cut(s) 88
BssMI GATC 1 cut(s) 24
BssSI CACGAG 1 cut(s) 20
Bst2BI CACGAG 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 171
BstBAI YACGTR 1 cut(s) 343
BstF5I GGATG 3 cut(s) 60, 83, 147
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 1 cut(s) 318
BstMBI GATC 1 cut(s) 24
BtgZI GCGATG 1 cut(s) 151
BtsCI GGATG 3 cut(s) 60, 83, 147
BtsIMutI CAGTG 1 cut(s) 232
Csp6I GTAC 2 cut(s) 286, 340
CviAII CATG 1 cut(s) 49
CviJI RGCY 4 cut(s) 5, 18, 80, 291
CviKI_1 RGCY 4 cut(s) 5, 18, 80, 291
CviQI GTAC 2 cut(s) 286, 340
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
FaeI CATG 1 cut(s) 52
FaiI YATR 4 cut(s) 9, 50, 294, 335
FatI CATG 1 cut(s) 48
FauI CCCGC 1 cut(s) 95
FbaI TGATCA 1 cut(s) 24
FblI GTMKAC 1 cut(s) 147
FokI GGATG 3 cut(s) 67, 70, 154
FspBI CTAG 2 cut(s) 125, 366
Hin1II CATG 1 cut(s) 52
HinfI GANTC 2 cut(s) 93, 255
HphI GGTGA 1 cut(s) 19
Hpy166II GTNNAC 2 cut(s) 148, 351
Hpy188I TCNGA 1 cut(s) 323
Hpy188III TCNNGA 4 cut(s) 22, 205, 234, 366
Hpy8I GTNNAC 2 cut(s) 148, 351
Hpy99I CGWCG 1 cut(s) 176
HpyAV CCTTC 1 cut(s) 175
HpyCH4IV ACGT 1 cut(s) 342
HpyCH4V TGCA 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 342
Hsp92II CATG 1 cut(s) 52
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 24
LmnI GCTCC 1 cut(s) 296
LpnPI CCDG 1 cut(s) 285
MaeI CTAG 2 cut(s) 125, 366
MaeII ACGT 1 cut(s) 342
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 2 cut(s) 188, 193
MluCI AATT 3 cut(s) 109, 128, 372
MmeI TCCRAC 1 cut(s) 195
MnlI CCTC 3 cut(s) 29, 40, 180
MslI CAYNNNNRTG 1 cut(s) 53
NdeII GATC 1 cut(s) 24
NlaIII CATG 1 cut(s) 52
PfeI GAWTC 2 cut(s) 93, 255
Ppu21I YACGTR 1 cut(s) 343
PsrI GAACNNNNNNTAC 2 cut(s) 332, 364
RsaI GTAC 2 cut(s) 287, 341
RsaNI GTAC 2 cut(s) 286, 340
RseI CAYNNNNRTG 1 cut(s) 53
Sau3AI GATC 1 cut(s) 24
SetI ASST 2 cut(s) 32, 345
SmiMI CAYNNNNRTG 1 cut(s) 53
SmlI CTYRAG 1 cut(s) 328
SmoI CTYRAG 1 cut(s) 328
Sse9I AATT 3 cut(s) 109, 128, 372
SsiI CCGC 1 cut(s) 88
SspMI CTAG 2 cut(s) 125, 366
TaiI ACGT 1 cut(s) 345
TaqI TCGA 1 cut(s) 153
TasI AATT 3 cut(s) 109, 128, 372
TfiI GAWTC 2 cut(s) 93, 255
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 1 cut(s) 34
TspRI CASTG 1 cut(s) 232
XapI RAATTY 2 cut(s) 109, 128
XbaI TCTAGA 1 cut(s) 365
XmiI GTMKAC 1 cut(s) 147
XspI CTAG 2 cut(s) 125, 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.