Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002308.1

Orthogroup ID

OG0003280

Physical Location & Seq

Genomic Coordinates Forward (+)

17008 .. 19144

Gene Structure 2137 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002308.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

atgcagatctggtgggagctgtgctctgagctaggccgtgcaacttggcttgatgaggaaagacgcggcgaggctcggcttgacaaatctggttcggcaacatcaacagccacccgtccactttcagccaattctgatgatctcatcaaagtgtttgaggattgggccctcgaacacaaacgcgtctatcctactgaagaagagaaacaaaggcgatttgaaaacttcagagcaacgtatgagttcgtggacaaattatacaaggaaggtagtgagagtaaactctacacagtcggcctgaatgcatttgctgacatgacaaacgaagaattctacaatgctcatgcttgctttgtagatcatgcctacgacgtcgtctcaagctcgaccaccacctcgtcatcatcatctgctaaagtttatgaaaacaaaaagcaagaattatgtggcggagtgactgattgggccgctttgggaatgattagagctcatacatctctctcactttgccgatctaattgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 ko04142 ko04145 ko04210 ko04612 ko04621 ko04924 ko05205 ko05323 ko05418 map04140 map04142 map04145 map04210 map04612 map04621 map04924 map05205 map05323 map05418

Pfam Domains

Protein Families

Granulin Inhibitor_I29 Peptidase_C1

Protein Analysis

174

Amino Acids

19.81

Weight (kDa)

5.18

Isoelectric Point (pI)

39.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003280)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g32080
malus_domestica	MD12G1005400.v1.1 MD12G1005800.v1.1 MD12G1005900.v1.1 MD12G1006100.v1.1
rosa_chinensis	RchiOBHm_Chr1g0315921 RchiOBHm_Chr7g0214921
rosa_laevigata	RLG00000002708 RLG00000029343 RLG00000030723
rosa_multiflora	Rmu_co8234753.1_g000001 Rmu_sc0002308.1_g000003 Rmu_sc0002886.1_g000001 Rmu_sc0004614.1_g000001 Rmu_sc0006316.1_g000002 Rmu_sc0007921.1_g000002 Rmu_sc0012813.1_g000001 Rmu_ssc0000134.1_g000025 Rmu_ssc0000154.1_g000024
rosa_roxburghii	Rroxscaffold_3G00244880 Rroxscaffold_4G00315430 Rroxscaffold_4G00331310
rosa_rugosa	Rorug01G0007000 Rorug04G0097100 Rorug07G0148700
rosa_samantha	Rh1AG017800 Rh1AG148200 Rh1DG010800 Rh1DG154900 Rh7AG285500 Rh7AG294300 Rh7BG285900 Rh7CG314300
rosa_wichuraiana	Rw1G001080 Rw1G011970 Rw7G024360 Rw7G025400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	375
AccII	CGCG	2 cut(s)	66, 183
AciI	CCGC	3 cut(s)	66, 450, 468
AcsI	RAATTY	1 cut(s)	329
AcuI	CTGAAG	2 cut(s)	211, 216
AcyI	GRCGYC	1 cut(s)	372
AflIII	ACRYGT	1 cut(s)	181
AgsI	TTSAA	1 cut(s)	221
AluBI	AGCT	4 cut(s)	19, 31, 384, 488
AluI	AGCT	4 cut(s)	19, 31, 384, 488
Alw21I	GWGCWC	2 cut(s)	26, 490
Alw26I	GTCTC	1 cut(s)	382
AoxI	GGCC	4 cut(s)	34, 165, 295, 465
ApaI	GGGCCC	1 cut(s)	169
ApoI	RAATTY	1 cut(s)	329
AspS9I	GGNCC	3 cut(s)	165, 166, 465
BaeGI	GKGCMC	1 cut(s)	169
BanII	GRGCYC	2 cut(s)	169, 490
Bbv12I	GWGCWC	2 cut(s)	26, 490
BceAI	ACGGC	1 cut(s)	21
BcoDI	GTCTC	1 cut(s)	382
BfaI	CTAG	1 cut(s)	32
BglII	AGATCT	1 cut(s)	6
BisI	GCNGC	2 cut(s)	67, 468
BlsI	GCNGC	2 cut(s)	68, 469
BmgT120I	GGNCC	3 cut(s)	165, 166, 465
BmiI	GGNNCC	1 cut(s)	167
BplI	GAGNNNNNCTC	2 cut(s)	8, 40
BpuEI	CTTGAG	1 cut(s)	364
BsaHI	GRCGYC	1 cut(s)	372
BseMII	CTCAG	1 cut(s)	18
BseSI	GKGCMC	1 cut(s)	169
Bsh1236I	CGCG	2 cut(s)	66, 183
BshFI	GGCC	4 cut(s)	36, 167, 297, 467
BsiHKAI	GWGCWC	2 cut(s)	26, 490
BsmAI	GTCTC	1 cut(s)	382
BsmBI	CGTCTC	1 cut(s)	382
BsmI	GAATGC	1 cut(s)	307
BsnI	GGCC	4 cut(s)	36, 167, 297, 467
Bsp120I	GGGCCC	1 cut(s)	165
Bsp1286I	GDGCHC	3 cut(s)	26, 169, 490
Bsp143I	GATC	4 cut(s)	6, 139, 358, 512
BspACI	CCGC	3 cut(s)	66, 450, 468
BspANI	GGCC	4 cut(s)	36, 167, 297, 467
BspCNI	CTCAG	1 cut(s)	19
BspFNI	CGCG	2 cut(s)	66, 183
BspLI	GGNNCC	1 cut(s)	167
BssMI	GATC	4 cut(s)	6, 139, 358, 512
BssNI	GRCGYC	1 cut(s)	372
Bst4CI	ACNGT	1 cut(s)	292
Bst6I	CTCTTC	1 cut(s)	195
BstACI	GRCGYC	1 cut(s)	372
BstC8I	GCNNGC	1 cut(s)	349
BstDEI	CTNAG	1 cut(s)	27
BstFNI	CGCG	2 cut(s)	66, 183
BstKTI	GATC	4 cut(s)	9, 142, 361, 515
BstMAI	GTCTC	1 cut(s)	382
BstMBI	GATC	4 cut(s)	6, 139, 358, 512
BstSLI	GKGCMC	1 cut(s)	169
BstUI	CGCG	2 cut(s)	66, 183
BstX2I	RGATCY	1 cut(s)	6
BstYI	RGATCY	1 cut(s)	6
BsuRI	GGCC	4 cut(s)	36, 167, 297, 467
Cac8I	GCNNGC	1 cut(s)	349
Cfr13I	GGNCC	3 cut(s)	165, 166, 465
CseI	GACGC	2 cut(s)	72, 172
CviAII	CATG	3 cut(s)	316, 344, 362
DdeI	CTNAG	1 cut(s)	27
DpnI	GATC	4 cut(s)	8, 141, 360, 514
DpnII	GATC	4 cut(s)	6, 139, 358, 512
Eam1104I	CTCTTC	1 cut(s)	195
EarI	CTCTTC	1 cut(s)	195
EciI	GGCGGA	1 cut(s)	465
Ecl136II	GAGCTC	1 cut(s)	488
Eco24I	GRGCYC	2 cut(s)	169, 490
Eco53kI	GAGCTC	1 cut(s)	488
Eco57I	CTGAAG	2 cut(s)	211, 216
EcoICRI	GAGCTC	1 cut(s)	488
EcoO109I	RGGNCCY	1 cut(s)	166
EcoRI	GAATTC	1 cut(s)	329
EcoT22I	ATGCAT	1 cut(s)	307
EcoT38I	GRGCYC	2 cut(s)	169, 490
Esp3I	CGTCTC	1 cut(s)	382
FaeI	CATG	3 cut(s)	319, 347, 365
FaiI	YATR	8 cut(s)	240, 259, 317, 345, 363, 423, 445, 492
FatI	CATG	3 cut(s)	315, 343, 361
Fnu4HI	GCNGC	2 cut(s)	67, 468
FriOI	GRGCYC	2 cut(s)	169, 490
Fsp4HI	GCNGC	2 cut(s)	67, 468
FspBI	CTAG	1 cut(s)	32
GluI	GCNGC	2 cut(s)	67, 468
HaeIII	GGCC	4 cut(s)	36, 167, 297, 467
HgaI	GACGC	2 cut(s)	72, 172
Hin1I	GRCGYC	1 cut(s)	372
Hin1II	CATG	3 cut(s)	319, 347, 365
Hpy166II	GTNNAC	3 cut(s)	119, 250, 281
Hpy188I	TCNGA	3 cut(s)	28, 136, 230
Hpy8I	GTNNAC	3 cut(s)	119, 250, 281
Hpy99I	CGWCG	2 cut(s)	374, 377
HpyAV	CCTTC	1 cut(s)	260
HpyCH4III	ACNGT	1 cut(s)	292
HpyCH4IV	ACGT	2 cut(s)	236, 372
HpyCH4V	TGCA	3 cut(s)	4, 41, 305
HpyF3I	CTNAG	1 cut(s)	27
HpySE526I	ACGT	2 cut(s)	236, 372
Hsp92I	GRCGYC	1 cut(s)	372
Hsp92II	CATG	3 cut(s)	319, 347, 365
Kzo9I	GATC	4 cut(s)	6, 139, 358, 512
LmnI	GCTCC	1 cut(s)	16
LpnPI	CCDG	2 cut(s)	75, 311
MaeI	CTAG	1 cut(s)	32
MaeII	ACGT	2 cut(s)	236, 372
MaeIII	GTNAC	1 cut(s)	454
MalI	GATC	4 cut(s)	8, 141, 360, 514
MboI	GATC	4 cut(s)	6, 139, 358, 512
MboII	GAAGA	3 cut(s)	209, 212, 338
MflI	RGATCY	1 cut(s)	6
MhlI	GDGCHC	3 cut(s)	26, 169, 490
MluCI	AATT	5 cut(s)	130, 254, 329, 440, 517
MluI	ACGCGT	1 cut(s)	181
MnlI	CCTC	5 cut(s)	49, 64, 151, 179, 406
Mph1103I	ATGCAT	1 cut(s)	307
MseI	TTAA	1 cut(s)	523
MslI	CAYNNNNRTG	1 cut(s)	149
Mva1269I	GAATGC	1 cut(s)	307
MvnI	CGCG	2 cut(s)	66, 183
NdeII	GATC	4 cut(s)	6, 139, 358, 512
NlaIII	CATG	3 cut(s)	319, 347, 365
NlaIV	GGNNCC	1 cut(s)	167
NmeAIII	GCCGAG	1 cut(s)	55
NmuCI	GTSAC	1 cut(s)	454
NsiI	ATGCAT	1 cut(s)	307
PctI	GAATGC	1 cut(s)	307
PflFI	GACNNNGTC	1 cut(s)	374
PkrI	GCNGC	2 cut(s)	68, 469
Psp124BI	GAGCTC	1 cut(s)	490
PspN4I	GGNNCC	1 cut(s)	167
PspOMI	GGGCCC	1 cut(s)	165
PspPI	GGNCC	3 cut(s)	165, 166, 465
PsuI	RGATCY	1 cut(s)	6
PsyI	GACNNNGTC	1 cut(s)	374
RseI	CAYNNNNRTG	1 cut(s)	149
SacI	GAGCTC	1 cut(s)	490
SaqAI	TTAA	1 cut(s)	523
SatI	GCNGC	2 cut(s)	67, 468
Sau3AI	GATC	4 cut(s)	6, 139, 358, 512
Sau96I	GGNCC	3 cut(s)	165, 166, 465
SduI	GDGCHC	3 cut(s)	26, 169, 490
SetI	ASST	8 cut(s)	21, 33, 239, 271, 375, 386, 398, 490
SmiMI	CAYNNNNRTG	1 cut(s)	149
SmlI	CTYRAG	1 cut(s)	379
SmoI	CTYRAG	1 cut(s)	379
Sse9I	AATT	5 cut(s)	130, 254, 329, 440, 517
SsiI	CCGC	3 cut(s)	66, 450, 468
SspMI	CTAG	1 cut(s)	32
SstI	GAGCTC	1 cut(s)	490
TaaI	ACNGT	1 cut(s)	292
TaiI	ACGT	2 cut(s)	239, 375
TaqI	TCGA	2 cut(s)	171, 386
TasI	AATT	5 cut(s)	130, 254, 329, 440, 517
TauI	GCSGC	2 cut(s)	69, 470
Tru1I	TTAA	1 cut(s)	523
Tru9I	TTAA	1 cut(s)	523
TseFI	GTSAC	1 cut(s)	454
Tsp45I	GTSAC	1 cut(s)	454
TspDTI	ATGAA	1 cut(s)	438
Tth111I	GACNNNGTC	1 cut(s)	374
XapI	RAATTY	1 cut(s)	329
XspI	CTAG	1 cut(s)	32
ZraI	GACGTC	1 cut(s)	373
Zsp2I	ATGCAT	1 cut(s)	307

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.