Rmu_ssc0000154.1_g000024

cysteine-type peptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000154.1
Physical Location & Seq
Reverse (-)
134230 .. 135979
1750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000154.1_g000024.1.cds

Sequence Viewer

Length: 798 bp
atggcttatacaaaaagcctcgcgatcacctccacattattattcatcatgtggctggggattttgggaacatcagaagccacatcccgcagattcaaagagaatccaaattctactcttttcctagaatttgagcgatggatggcagccttcgacaaacattacccgaacgacgaagagaaggagaggcgtttcgcaatcttcaagaacaagttggagtgggtcaagaacttcaacaagcaagggaatcactcttttacggtaggaatcaatcaattttctgatatgacccctgatgaattccggctatgtgctactggccgccgccgcagccaccccagcttaagctctagtgtggtcgactcctccaggtggctgatctgggttctgcctttatttggcattatagccgtgttgatgtgtggtacggctatggagcagggttgcccaccaagcttgctgccggcaaagcagccgcaccacatccaaacctcgccgcactgccgctccgcaaagcagacccccctagaacccaacagacgtactagactgaagtcccagccgctggccagatgccgcaatgacgccatcacccgtcaccggcaagccccaccccagagctgctccactcctgccctcatccccgatcccagaagaatagatcgagatcgatcagtcctctccaagatcccgcaaccattctccaaccctggaccaaaccgttaccacaaaacaacgctgctagcccgaatcaccatcctctcccaggccagaacgaagcggcagcaacgcaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

265

Amino Acids

30.49

Weight (kDa)

10.66

Isoelectric Point (pI)

67.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 783
Acc36I ACCTGC 1 cut(s) 783
AccB7I CCANNNNNTGG 1 cut(s) 565
AccBSI CCGCTC 1 cut(s) 507
AccI GTMKAC 1 cut(s) 360
AccII CGCG 1 cut(s) 23
AclWI GGATC 2 cut(s) 641, 682
AcoI YGGCCR 2 cut(s) 319, 567
AcsI RAATTY 3 cut(s) 109, 128, 299
AcuI CTGAAG 1 cut(s) 572
AcyI GRCGYC 1 cut(s) 585
AfaI GTAC 2 cut(s) 427, 544
AfiI CCNNNNNNNGG 5 cut(s) 372, 398, 565, 600, 766
AflII CTTAAG 1 cut(s) 343
AgsI TTSAA 3 cut(s) 97, 205, 235
AjnI CCWGG 3 cut(s) 368, 709, 765
AluBI AGCT 4 cut(s) 342, 348, 456, 621
AluI AGCT 4 cut(s) 342, 348, 456, 621
AlwI GGATC 2 cut(s) 641, 682
AlwNI CAGNNNCTG 1 cut(s) 565
AoxI GGCC 3 cut(s) 319, 567, 768
ApeKI GCWGC 7 cut(s) 146, 330, 460, 472, 621, 739, 784
ApoI RAATTY 3 cut(s) 109, 128, 299
AspS9I GGNCC 1 cut(s) 713
AsuHPI GGTGA 4 cut(s) 19, 583, 590, 745
AsuNHI GCTAGC 1 cut(s) 742
AvaII GGWCC 1 cut(s) 713
BalI TGGCCA 1 cut(s) 569
BbvI GCAGC 6 cut(s) 158, 342, 447, 484, 608, 726
BccI CCATC 4 cut(s) 132, 136, 596, 764
BceAI ACGGC 2 cut(s) 395, 444
BciT130I CCWGG 3 cut(s) 370, 711, 767
BfaI CTAG 5 cut(s) 125, 351, 527, 546, 743
BfrI CTTAAG 1 cut(s) 343
BfuAI ACCTGC 1 cut(s) 783
Bme1390I CCNGG 3 cut(s) 370, 711, 767
Bme18I GGWCC 1 cut(s) 713
BmgT120I GGNCC 1 cut(s) 713
BmrFI CCNGG 3 cut(s) 370, 711, 767
BmsI GCATC 1 cut(s) 563
BmtI GCTAGC 1 cut(s) 746
BoxI GACNNNNGTC 1 cut(s) 553
BpmI CTGGAG 1 cut(s) 352
Bsa29I ATCGAT 1 cut(s) 670
BsaBI GATNNNNATC 1 cut(s) 666
BsaHI GRCGYC 1 cut(s) 585
BsaJI CCNNGG 2 cut(s) 709, 765
BsaXI ACNNNNNCTCC 2 cut(s) 491, 521
Bsc4I CCNNNNNNNGG 5 cut(s) 372, 398, 565, 600, 766
Bse118I RCCGGY 2 cut(s) 463, 600
Bse1I ACTGG 1 cut(s) 322
Bse3DI GCAATG 1 cut(s) 586
Bse8I GATNNNNATC 1 cut(s) 666
BseBI CCWGG 3 cut(s) 370, 711, 767
BseCI ATCGAT 1 cut(s) 670
BseDI CCNNGG 2 cut(s) 709, 765
BseGI GGATG 5 cut(s) 83, 147, 483, 639, 756
BseJI GATNNNNATC 1 cut(s) 666
BseLI CCNNNNNNNGG 5 cut(s) 372, 398, 565, 600, 766
BseMI GCAATG 1 cut(s) 586
BseNI ACTGG 1 cut(s) 322
BseRI GAGGAG 1 cut(s) 355
BseXI GCAGC 6 cut(s) 158, 342, 447, 484, 608, 726
BseYI CCCAGC 3 cut(s) 55, 338, 558
Bsh1236I CGCG 1 cut(s) 23
BshFI GGCC 3 cut(s) 321, 569, 770
BshVI ATCGAT 1 cut(s) 670
BsiSI CCGG 3 cut(s) 304, 464, 601
BslFI GGGAC 1 cut(s) 541
BslI CCNNNNNNNGG 5 cut(s) 372, 398, 565, 600, 766
BsmFI GGGAC 1 cut(s) 541
BsnI GGCC 3 cut(s) 321, 569, 770
Bsp143I GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
Bsp68I TCGCGA 1 cut(s) 23
BspANI GGCC 3 cut(s) 321, 569, 770
BspDI ATCGAT 1 cut(s) 670
BspFNI CGCG 1 cut(s) 23
BspMI ACCTGC 1 cut(s) 783
BspOI GCTAGC 1 cut(s) 746
BspPI GGATC 2 cut(s) 641, 682
BspTI CTTAAG 1 cut(s) 343
BsrBI CCGCTC 1 cut(s) 507
BsrDI GCAATG 1 cut(s) 586
BsrFI RCCGGY 2 cut(s) 463, 600
BsrI ACTGG 1 cut(s) 322
BssAI RCCGGY 2 cut(s) 463, 600
BssECI CCNNGG 2 cut(s) 709, 765
BssMI GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
BssNI GRCGYC 1 cut(s) 585
Bst2UI CCWGG 3 cut(s) 370, 711, 767
Bst4CI ACNGT 2 cut(s) 262, 722
Bst6I CTCTTC 1 cut(s) 171
BstACI GRCGYC 1 cut(s) 585
BstAFI CTTAAG 1 cut(s) 343
BstC8I GCNNGC 5 cut(s) 458, 465, 567, 606, 744
BstENI CCTNNNNNAGG 1 cut(s) 764
BstF5I GGATG 5 cut(s) 83, 147, 483, 639, 756
BstFNI CGCG 1 cut(s) 23
BstKTI GATC 7 cut(s) 27, 381, 649, 664, 670, 674, 690
BstMBI GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
BstMWI GCNNNNNNNGC 5 cut(s) 327, 330, 339, 453, 469
BstNI CCWGG 3 cut(s) 370, 711, 767
BstPAI GACNNNNGTC 1 cut(s) 553
BstSCI CCNGG 3 cut(s) 368, 709, 765
BstUI CGCG 1 cut(s) 23
BstV1I GCAGC 6 cut(s) 158, 342, 447, 484, 608, 726
BstX2I RGATCY 1 cut(s) 687
BstYI RGATCY 1 cut(s) 687
Bsu15I ATCGAT 1 cut(s) 670
BsuRI GGCC 3 cut(s) 321, 569, 770
BsuTUI ATCGAT 1 cut(s) 670
BtgZI GCGATG 1 cut(s) 151
BtsCI GGATG 5 cut(s) 83, 147, 483, 639, 756
BtsI GCAGTG 1 cut(s) 499
BtsIMutI CAGTG 1 cut(s) 499
BtuMI TCGCGA 1 cut(s) 23
BveI ACCTGC 1 cut(s) 783
Cac8I GCNNGC 5 cut(s) 458, 465, 567, 606, 744
CaiI CAGNNNCTG 1 cut(s) 565
Cfr10I RCCGGY 2 cut(s) 463, 600
Cfr13I GGNCC 1 cut(s) 713
ClaI ATCGAT 1 cut(s) 670
CseI GACGC 1 cut(s) 593
Csp6I GTAC 2 cut(s) 426, 543
CspCI CAANNNNNGTGG 2 cut(s) 438, 473
CviAII CATG 1 cut(s) 49
CviQI GTAC 2 cut(s) 426, 543
DpnI GATC 7 cut(s) 26, 380, 648, 663, 669, 673, 689
DpnII GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
EaeI YGGCCR 2 cut(s) 319, 567
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
Eco47I GGWCC 1 cut(s) 713
Eco57I CTGAAG 1 cut(s) 572
EcoNI CCTNNNNNAGG 1 cut(s) 764
EcoRI GAATTC 1 cut(s) 299
EcoRII CCWGG 3 cut(s) 368, 709, 765
FaeI CATG 1 cut(s) 52
FaiI YATR 6 cut(s) 9, 50, 287, 310, 407, 434
FaqI GGGAC 1 cut(s) 541
FatI CATG 1 cut(s) 48
FauI CCCGC 2 cut(s) 95, 699
FblI GTMKAC 1 cut(s) 360
FokI GGATG 5 cut(s) 70, 154, 470, 626, 743
FspBI CTAG 5 cut(s) 125, 351, 527, 546, 743
GsaI CCCAGC 3 cut(s) 59, 342, 562
GsuI CTGGAG 1 cut(s) 352
HaeIII GGCC 3 cut(s) 321, 569, 770
HapII CCGG 3 cut(s) 304, 464, 601
HgaI GACGC 1 cut(s) 593
Hin1I GRCGYC 1 cut(s) 585
Hin1II CATG 1 cut(s) 52
HincII GTYRAC 1 cut(s) 361
HindII GTYRAC 1 cut(s) 361
HindIII AAGCTT 1 cut(s) 454
HinfI GANTC 6 cut(s) 93, 103, 247, 267, 362, 750
HpaII CCGG 3 cut(s) 304, 464, 601
HphI GGTGA 4 cut(s) 19, 583, 590, 745
Hpy166II GTNNAC 1 cut(s) 361
Hpy188I TCNGA 2 cut(s) 76, 283
Hpy188III TCNNGA 4 cut(s) 22, 205, 226, 665
Hpy8I GTNNAC 1 cut(s) 361
Hpy99I CGWCG 1 cut(s) 176
HpyAV CCTTC 2 cut(s) 160, 175
HpyCH4III ACNGT 2 cut(s) 262, 722
HpyCH4IV ACGT 1 cut(s) 541
HpyF10VI GCNNNNNNNGC 5 cut(s) 327, 330, 339, 453, 469
HpySE526I ACGT 1 cut(s) 541
Hsp92I GRCGYC 1 cut(s) 585
Hsp92II CATG 1 cut(s) 52
KroI GCCGGC 1 cut(s) 463
KroNI GCCGGC 1 cut(s) 465
Kzo9I GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
LmnI GCTCC 3 cut(s) 436, 512, 629
Lsp1109I GCAGC 6 cut(s) 158, 342, 447, 484, 608, 726
LweI GCATC 1 cut(s) 563
MaeI CTAG 5 cut(s) 125, 351, 527, 546, 743
MaeII ACGT 1 cut(s) 541
MaeIII GTNAC 2 cut(s) 596, 722
MalI GATC 7 cut(s) 26, 380, 648, 663, 669, 673, 689
MbiI CCGCTC 1 cut(s) 507
MboI GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
MboII GAAGA 3 cut(s) 188, 193, 666
MflI RGATCY 1 cut(s) 687
MlsI TGGCCA 1 cut(s) 569
MluCI AATT 4 cut(s) 109, 128, 275, 299
MluNI TGGCCA 1 cut(s) 569
MlyI GAGTC 1 cut(s) 356
MmeI TCCRAC 2 cut(s) 195, 729
MnlI CCTC 8 cut(s) 29, 40, 180, 376, 502, 647, 689, 770
Mox20I TGGCCA 1 cut(s) 569
MroNI GCCGGC 1 cut(s) 463
MscI TGGCCA 1 cut(s) 569
MseI TTAA 1 cut(s) 344
Msp20I TGGCCA 1 cut(s) 569
MspA1I CMGCKG 1 cut(s) 565
MspCI CTTAAG 1 cut(s) 343
MspI CCGG 3 cut(s) 304, 464, 601
MspR9I CCNGG 3 cut(s) 370, 711, 767
MvaI CCWGG 3 cut(s) 370, 711, 767
MvnI CGCG 1 cut(s) 23
MwoI GCNNNNNNNGC 5 cut(s) 327, 330, 339, 453, 469
NaeI GCCGGC 1 cut(s) 465
NdeII GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
NgoMIV GCCGGC 1 cut(s) 463
NheI GCTAGC 1 cut(s) 742
NlaIII CATG 1 cut(s) 52
NmuCI GTSAC 1 cut(s) 596
NruI TCGCGA 1 cut(s) 23
PaqCI CACCTGC 1 cut(s) 783
PdiI GCCGGC 1 cut(s) 465
PfeI GAWTC 5 cut(s) 93, 103, 247, 267, 750
PflMI CCANNNNNTGG 1 cut(s) 565
PleI GAGTC 1 cut(s) 356
PpsI GAGTC 1 cut(s) 356
PshAI GACNNNNGTC 1 cut(s) 553
Psp6I CCWGG 3 cut(s) 368, 709, 765
PspFI CCCAGC 3 cut(s) 55, 338, 558
PspGI CCWGG 3 cut(s) 368, 709, 765
PspPI GGNCC 1 cut(s) 713
PstNI CAGNNNCTG 1 cut(s) 565
PsuI RGATCY 1 cut(s) 687
RruI TCGCGA 1 cut(s) 23
RsaI GTAC 2 cut(s) 427, 544
RsaNI GTAC 2 cut(s) 426, 543
SalI GTCGAC 1 cut(s) 359
SaqAI TTAA 1 cut(s) 344
Sau3AI GATC 7 cut(s) 24, 378, 646, 661, 667, 671, 687
Sau96I GGNCC 1 cut(s) 713
SchI GAGTC 1 cut(s) 356
ScrFI CCNGG 3 cut(s) 370, 711, 767
SetI ASST 9 cut(s) 32, 344, 350, 374, 458, 494, 544, 623, 797
SfaNI GCATC 1 cut(s) 563
SinI GGWCC 1 cut(s) 713
SmlI CTYRAG 1 cut(s) 343
SmoI CTYRAG 1 cut(s) 343
Sse9I AATT 4 cut(s) 109, 128, 275, 299
SspMI CTAG 5 cut(s) 125, 351, 527, 546, 743
StyD4I CCNGG 3 cut(s) 368, 709, 765
TaaI ACNGT 2 cut(s) 262, 722
TaiI ACGT 1 cut(s) 544
TaqI TCGA 4 cut(s) 153, 360, 664, 670
TasI AATT 4 cut(s) 109, 128, 275, 299
TauI GCSGC 9 cut(s) 324, 327, 330, 478, 499, 507, 565, 579, 784
TfiI GAWTC 5 cut(s) 93, 103, 247, 267, 750
Tru1I TTAA 1 cut(s) 344
Tru9I TTAA 1 cut(s) 344
TscAI CASTG 1 cut(s) 506
TseFI GTSAC 1 cut(s) 596
TseI GCWGC 7 cut(s) 146, 330, 460, 472, 621, 739, 784
Tsp45I GTSAC 1 cut(s) 596
TspDTI ATGAA 2 cut(s) 34, 312
TspRI CASTG 1 cut(s) 506
Van91I CCANNNNNTGG 1 cut(s) 565
Vha464I CTTAAG 1 cut(s) 343
VpaK11BI GGWCC 1 cut(s) 713
XagI CCTNNNNNAGG 1 cut(s) 764
XapI RAATTY 3 cut(s) 109, 128, 299
XmiI GTMKAC 1 cut(s) 360
XspI CTAG 5 cut(s) 125, 351, 527, 546, 743
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.