Rmu_co7982498.1_g000001

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7982498.1
Physical Location & Seq
Forward (+)
1 .. 279
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7982498.1_g000001.1.cds

Sequence Viewer

Length: 225 bp
ttggtgggaaattcaaacgtccccgcctcatacggcggcgtttcgtcctccgattccgtctccggcgctctcagctctcgcgcatttccgagacggttgacggtcttcgccaaccgcacgatgacggagaagcagttgatcgtggtcgttgaaggcacggcggccatcgggccttactggtcagccgtcgtctccgattacgtcgagaagatcatcaggtcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.82

Weight (kDa)

9.4

Isoelectric Point (pI)

40.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 81
AciI CCGC 4 cut(s) 24, 36, 115, 161
AcoI YGGCCR 1 cut(s) 162
AcsI RAATTY 1 cut(s) 10
AgsI TTSAA 2 cut(s) 15, 152
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
Alw26I GTCTC 3 cut(s) 64, 85, 196
AoxI GGCC 2 cut(s) 162, 170
ApoI RAATTY 1 cut(s) 10
AspLEI GCGC 2 cut(s) 68, 83
AspS9I GGNCC 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 97
BccI CCATC 1 cut(s) 173
BceAI ACGGC 3 cut(s) 49, 170, 174
BcoDI GTCTC 3 cut(s) 64, 85, 196
BfoI RGCGCY 1 cut(s) 69
BisI GCNGC 2 cut(s) 37, 162
BlsI GCNGC 2 cut(s) 38, 163
BmgT120I GGNCC 1 cut(s) 170
BpiI GAAGAC 1 cut(s) 97
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bse1I ACTGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 81
BshFI GGCC 2 cut(s) 164, 172
BsiSI CCGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 5
BsmAI GTCTC 3 cut(s) 64, 85, 196
BsmBI CGTCTC 3 cut(s) 64, 85, 196
BsmFI GGGAC 1 cut(s) 5
BsnI GGCC 2 cut(s) 164, 172
Bsp143I GATC 2 cut(s) 138, 210
BspACI CCGC 4 cut(s) 24, 36, 115, 161
BspANI GGCC 2 cut(s) 164, 172
BspCNI CTCAG 1 cut(s) 84
BspFNI CGCG 1 cut(s) 81
BsrI ACTGG 1 cut(s) 182
BssMI GATC 2 cut(s) 138, 210
Bst4CI ACNGT 2 cut(s) 96, 103
BstDEI CTNAG 1 cut(s) 71
BstFNI CGCG 1 cut(s) 81
BstH2I RGCGCY 1 cut(s) 69
BstHHI GCGC 2 cut(s) 68, 83
BstKTI GATC 2 cut(s) 141, 213
BstMAI GTCTC 3 cut(s) 64, 85, 196
BstMBI GATC 2 cut(s) 138, 210
BstMWI GCNNNNNNNGC 1 cut(s) 72
BstUI CGCG 1 cut(s) 81
BstV2I GAAGAC 1 cut(s) 97
BsuRI GGCC 2 cut(s) 164, 172
CfoI GCGC 2 cut(s) 68, 83
Cfr13I GGNCC 1 cut(s) 170
CviJI RGCY 4 cut(s) 75, 164, 172, 185
CviKI_1 RGCY 4 cut(s) 75, 164, 172, 185
DdeI CTNAG 1 cut(s) 71
DpnI GATC 2 cut(s) 140, 212
DpnII GATC 2 cut(s) 138, 210
EaeI YGGCCR 1 cut(s) 162
Esp3I CGTCTC 3 cut(s) 64, 85, 196
FaiI YATR 1 cut(s) 31
FaqI GGGAC 1 cut(s) 5
FauI CCCGC 1 cut(s) 31
Fnu4HI GCNGC 2 cut(s) 37, 162
Fsp4HI GCNGC 2 cut(s) 37, 162
GlaI GCGC 2 cut(s) 67, 82
GluI GCNGC 2 cut(s) 37, 162
HaeII RGCGCY 1 cut(s) 69
HaeIII GGCC 2 cut(s) 164, 172
HapII CCGG 1 cut(s) 63
HhaI GCGC 2 cut(s) 68, 83
Hin6I GCGC 2 cut(s) 66, 81
HinP1I GCGC 2 cut(s) 66, 81
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
HinfI GANTC 1 cut(s) 53
HpaII CCGG 1 cut(s) 63
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 3 cut(s) 52, 90, 196
Hpy188III TCNNGA 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 99
Hpy99I CGWCG 2 cut(s) 191, 206
HpyAV CCTTC 1 cut(s) 146
HpyCH4III ACNGT 2 cut(s) 96, 103
HpyCH4IV ACGT 2 cut(s) 18, 201
HpyF10VI GCNNNNNNNGC 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 71
HpySE526I ACGT 2 cut(s) 18, 201
HspAI GCGC 2 cut(s) 66, 81
Kzo9I GATC 2 cut(s) 138, 210
LpnPI CCDG 3 cut(s) 76, 163, 202
MaeII ACGT 2 cut(s) 18, 201
MalI GATC 2 cut(s) 140, 212
MboI GATC 2 cut(s) 138, 210
MboII GAAGA 2 cut(s) 97, 220
MluCI AATT 1 cut(s) 10
MnlI CCTC 2 cut(s) 37, 58
MspI CCGG 1 cut(s) 63
MvnI CGCG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 72
NdeII GATC 2 cut(s) 138, 210
PfeI GAWTC 1 cut(s) 53
PkrI GCNGC 2 cut(s) 38, 163
PspPI GGNCC 1 cut(s) 170
SatI GCNGC 2 cut(s) 37, 162
Sau3AI GATC 2 cut(s) 138, 210
Sau96I GGNCC 1 cut(s) 170
SetI ASST 4 cut(s) 21, 77, 204, 221
Sse9I AATT 1 cut(s) 10
SsiI CCGC 4 cut(s) 24, 36, 115, 161
TaaI ACNGT 2 cut(s) 96, 103
TaiI ACGT 2 cut(s) 21, 204
TaqI TCGA 1 cut(s) 204
TasI AATT 1 cut(s) 10
TauI GCSGC 2 cut(s) 39, 164
TfiI GAWTC 1 cut(s) 53
TspGWI ACGGA 2 cut(s) 46, 140
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.