Rh5CG480200

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
66948785 .. 66950337
1553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG480200.1

Sequence Viewer

Length: 153 bp
ATGACGAAGAAGCAGGTTATCGTAGTCTTTGAAGTCACGGTGGCCATAGGGCCTTACTGGTCAGCCGTCGTCTCCGATTGCGTCAAGAAGGTCATCAGGAATCAATTACATAAGCATTTAGGTGACACTGGACATGCTTCACTGAAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.59

Weight (kDa)

9.9

Isoelectric Point (pI)

9.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 4
AcoI YGGCCR 1 cut(s) 42
AgsI TTSAA 1 cut(s) 32
Alw26I GTCTC 1 cut(s) 76
AoxI GGCC 2 cut(s) 42, 50
AspS9I GGNCC 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 134
BalI TGGCCA 1 cut(s) 44
BceAI ACGGC 1 cut(s) 50
BcoDI GTCTC 1 cut(s) 76
BfuAI ACCTGC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 50
Bse1I ACTGG 2 cut(s) 62, 133
BseNI ACTGG 2 cut(s) 62, 133
BshFI GGCC 2 cut(s) 44, 52
BsmAI GTCTC 1 cut(s) 76
BsmBI CGTCTC 1 cut(s) 76
BsnI GGCC 2 cut(s) 44, 52
BspANI GGCC 2 cut(s) 44, 52
BspMI ACCTGC 1 cut(s) 4
BsrI ACTGG 2 cut(s) 62, 133
Bst4CI ACNGT 1 cut(s) 40
Bst6I CTCTTC 1 cut(s) 140
BstMAI GTCTC 1 cut(s) 76
BstNSI RCATGY 1 cut(s) 137
BsuRI GGCC 2 cut(s) 44, 52
BtsIMutI CAGTG 2 cut(s) 126, 140
BveI ACCTGC 1 cut(s) 4
Cfr13I GGNCC 1 cut(s) 50
CseI GACGC 1 cut(s) 70
CviAII CATG 1 cut(s) 134
CviJI RGCY 3 cut(s) 44, 52, 65
CviKI_1 RGCY 3 cut(s) 44, 52, 65
EaeI YGGCCR 1 cut(s) 42
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 50
Esp3I CGTCTC 1 cut(s) 76
FaeI CATG 1 cut(s) 137
FaiI YATR 3 cut(s) 47, 111, 135
FatI CATG 1 cut(s) 133
HaeIII GGCC 2 cut(s) 44, 52
HgaI GACGC 1 cut(s) 70
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 100
HphI GGTGA 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 2 cut(s) 85, 97
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 40
Hsp92II CATG 1 cut(s) 137
LpnPI CCDG 3 cut(s) 43, 82, 114
MaeIII GTNAC 2 cut(s) 34, 122
MboII GAAGA 1 cut(s) 19
MlsI TGGCCA 1 cut(s) 44
MluCI AATT 1 cut(s) 104
MluNI TGGCCA 1 cut(s) 44
MnlI CCTC 1 cut(s) 141
Mox20I TGGCCA 1 cut(s) 44
MscI TGGCCA 1 cut(s) 44
MslI CAYNNNNRTG 1 cut(s) 120
Msp20I TGGCCA 1 cut(s) 44
NlaIII CATG 1 cut(s) 137
NmuCI GTSAC 2 cut(s) 34, 122
NspI RCATGY 1 cut(s) 137
PfeI GAWTC 1 cut(s) 100
PspPI GGNCC 1 cut(s) 50
RseI CAYNNNNRTG 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 50
SetI ASST 4 cut(s) 18, 93, 124, 152
SgeI CNNG 7 cut(s) 26, 49, 70, 97, 109, 141, 146
SmiMI CAYNNNNRTG 1 cut(s) 120
Sse9I AATT 1 cut(s) 104
TaaI ACNGT 1 cut(s) 40
TasI AATT 1 cut(s) 104
TfiI GAWTC 1 cut(s) 100
TscAI CASTG 2 cut(s) 133, 147
TseFI GTSAC 2 cut(s) 34, 122
Tsp45I GTSAC 2 cut(s) 34, 122
TspRI CASTG 2 cut(s) 133, 147
XceI RCATGY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.