Rh7CG011300

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
850709 .. 852259
1551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG011300.1

Sequence Viewer

Length: 213 bp
ATGACGGAGAAGCAAGTTATCGTGGTCTTTGAAGTCACGGCTGCCATAGGGCCTTACTGGTCAGCCGTCGTCTCCGATTACGTCGAGAAGTACGGATTTGATGGGAGTTTTGGTGGAAGTGAGTATCAAAGGCTTCCTCCTCCCCACCATTGGAAACAGAATCAATTACATAAGCATTTAGGTGACACTAGACATGCTTCACTGAGGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.05

Weight (kDa)

8.13

Isoelectric Point (pI)

40.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 1 cut(s) 32
Alw26I GTCTC 1 cut(s) 76
AoxI GGCC 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 194
BbvI GCAGC 1 cut(s) 28
BccI CCATC 1 cut(s) 95
BceAI ACGGC 2 cut(s) 50, 54
BcoDI GTCTC 1 cut(s) 76
BfaI CTAG 1 cut(s) 189
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
BmgT120I GGNCC 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 194
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 129
BseXI GCAGC 1 cut(s) 28
BshFI GGCC 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 76
BsmBI CGTCTC 1 cut(s) 76
BsnI GGCC 1 cut(s) 52
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 1 cut(s) 195
BsrI ACTGG 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 203
BstMAI GTCTC 1 cut(s) 76
BstNSI RCATGY 1 cut(s) 197
BstV1I GCAGC 1 cut(s) 28
BsuRI GGCC 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 200
Cfr13I GGNCC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 91
CviAII CATG 1 cut(s) 194
CviJI RGCY 4 cut(s) 41, 52, 65, 133
CviKI_1 RGCY 4 cut(s) 41, 52, 65, 133
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 203
EcoO109I RGGNCCY 1 cut(s) 50
Esp3I CGTCTC 1 cut(s) 76
FaeI CATG 1 cut(s) 197
FaiI YATR 3 cut(s) 47, 171, 195
FatI CATG 1 cut(s) 193
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 1 cut(s) 189
GluI GCNGC 1 cut(s) 42
HaeIII GGCC 1 cut(s) 52
Hin1II CATG 1 cut(s) 197
HinfI GANTC 1 cut(s) 160
HphI GGTGA 1 cut(s) 194
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 85
Hpy99I CGWCG 2 cut(s) 71, 86
HpyCH4IV ACGT 1 cut(s) 81
HpyF3I CTNAG 1 cut(s) 203
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 1 cut(s) 197
LpnPI CCDG 1 cut(s) 43
Lsp1109I GCAGC 1 cut(s) 28
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 34, 182
MluCI AATT 1 cut(s) 164
MnlI CCTC 4 cut(s) 147, 150, 198, 201
MslI CAYNNNNRTG 1 cut(s) 180
NlaIII CATG 1 cut(s) 197
NmuCI GTSAC 2 cut(s) 34, 182
NspI RCATGY 1 cut(s) 197
PfeI GAWTC 1 cut(s) 160
PkrI GCNGC 1 cut(s) 43
PspPI GGNCC 1 cut(s) 50
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 180
SatI GCNGC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 50
SetI ASST 3 cut(s) 84, 184, 212
SgeI CNNG 7 cut(s) 26, 34, 49, 70, 97, 201, 206
SmiMI CAYNNNNRTG 1 cut(s) 180
Sse9I AATT 1 cut(s) 164
SspMI CTAG 1 cut(s) 189
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 164
TfiI GAWTC 1 cut(s) 160
TscAI CASTG 1 cut(s) 207
TseFI GTSAC 2 cut(s) 34, 182
TseI GCWGC 1 cut(s) 41
Tsp45I GTSAC 2 cut(s) 34, 182
TspGWI ACGGA 2 cut(s) 20, 108
TspRI CASTG 1 cut(s) 207
XceI RCATGY 1 cut(s) 197
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.