Rmu_co8069786.1_g000001

protein phosphatase 2C 78

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8069786.1
OG0001678
Physical Location & Seq
Reverse (-)
92 .. 385
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8069786.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
atgttggagatgtgtaggagaccattggagaagtgctttggaggtggagatgatgagcttctatggcacacggacttgaagcctcactcttctggggagtattcaattgctgttgttcaggctaattcatctttggaagatcagggacaagtgttcacttctccttctgccacgtatgttggagtttatgacggccatggtggtcctgaagcttctagattcatcactcagcggctcttcccctttattcagagtgagcagaaacactacccttgttctaaattttttagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

97

Amino Acids

10.88

Weight (kDa)

5.42

Isoelectric Point (pI)

55.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AcoI YGGCCR 1 cut(s) 193
AcsI RAATTY 1 cut(s) 281
AcuI CTGAAG 1 cut(s) 228
AgsI TTSAA 2 cut(s) 79, 105
AluBI AGCT 3 cut(s) 58, 212, 291
AluI AGCT 3 cut(s) 58, 212, 291
Alw26I GTCTC 1 cut(s) 13
AoxI GGCC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 203
AvaII GGWCC 1 cut(s) 203
BceAI ACGGC 1 cut(s) 208
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 1 cut(s) 216
BisI GCNGC 1 cut(s) 233
BlsI GCNGC 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 203
BsaAI YACGTR 1 cut(s) 174
BsaI GGTCTC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 196
BseDI CCNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 242
BshFI GGCC 1 cut(s) 195
BslFI GGGAC 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 159
BsnI GGCC 1 cut(s) 195
Bso31I GGTCTC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 139
Bsp19I CCATGG 1 cut(s) 196
BspACI CCGC 1 cut(s) 232
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 1 cut(s) 241
BspQI GCTCTTC 1 cut(s) 242
BspTNI GGTCTC 1 cut(s) 13
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 1 cut(s) 139
BssT1I CCWWGG 1 cut(s) 196
Bst6I CTCTTC 2 cut(s) 94, 242
BstBAI YACGTR 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 228
BstDSI CCRYGG 1 cut(s) 196
BstKTI GATC 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 13
BstMBI GATC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 64
BsuRI GGCC 1 cut(s) 195
BtgI CCRYGG 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 203
CspCI CAANNNNNGTGG 2 cut(s) 160, 195
CviAII CATG 1 cut(s) 197
CviJI RGCY 7 cut(s) 58, 82, 122, 195, 212, 235, 291
CviKI_1 RGCY 7 cut(s) 58, 82, 122, 195, 212, 235, 291
DdeI CTNAG 1 cut(s) 228
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
EaeI YGGCCR 1 cut(s) 193
Eam1104I CTCTTC 2 cut(s) 94, 242
EarI CTCTTC 2 cut(s) 94, 242
Eco130I CCWWGG 1 cut(s) 196
Eco31I GGTCTC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 203
Eco57I CTGAAG 1 cut(s) 228
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 200
FaiI YATR 4 cut(s) 64, 177, 189, 198
FaqI GGGAC 1 cut(s) 159
FatI CATG 1 cut(s) 196
Fnu4HI GCNGC 1 cut(s) 233
Fsp4HI GCNGC 1 cut(s) 233
FspBI CTAG 1 cut(s) 216
GluI GCNGC 1 cut(s) 233
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 1 cut(s) 200
HindIII AAGCTT 1 cut(s) 210
HinfI GANTC 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 156
Hpy188I TCNGA 1 cut(s) 252
Hpy188III TCNNGA 2 cut(s) 206, 216
Hpy8I GTNNAC 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 174
HpyCH4IV ACGT 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 228
HpySE526I ACGT 1 cut(s) 173
Hsp92II CATG 1 cut(s) 200
Kzo9I GATC 1 cut(s) 139
LguI GCTCTTC 1 cut(s) 242
LpnPI CCDG 4 cut(s) 78, 104, 128, 219
MaeI CTAG 1 cut(s) 216
MaeII ACGT 1 cut(s) 173
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 3 cut(s) 81, 149, 229
MfeI CAATTG 1 cut(s) 105
MluCI AATT 3 cut(s) 105, 124, 281
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 2 cut(s) 35, 93
MspA1I CMGCKG 1 cut(s) 232
MunI CAATTG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 64
NcoI CCATGG 1 cut(s) 196
NdeII GATC 1 cut(s) 139
NlaIII CATG 1 cut(s) 200
PciSI GCTCTTC 1 cut(s) 242
PfeI GAWTC 1 cut(s) 219
PkrI GCNGC 1 cut(s) 234
Ppu21I YACGTR 1 cut(s) 174
PspPI GGNCC 1 cut(s) 203
SapI GCTCTTC 1 cut(s) 242
SatI GCNGC 1 cut(s) 233
Sau3AI GATC 1 cut(s) 139
Sau96I GGNCC 1 cut(s) 203
SetI ASST 5 cut(s) 46, 60, 176, 214, 293
SinI GGWCC 1 cut(s) 203
Sse9I AATT 3 cut(s) 105, 124, 281
SsiI CCGC 1 cut(s) 232
SspMI CTAG 1 cut(s) 216
StyI CCWWGG 1 cut(s) 196
TaiI ACGT 1 cut(s) 176
TasI AATT 3 cut(s) 105, 124, 281
TauI GCSGC 1 cut(s) 235
TfiI GAWTC 1 cut(s) 219
TspDTI ATGAA 2 cut(s) 117, 211
TspGWI ACGGA 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 203
XapI RAATTY 1 cut(s) 281
XbaI TCTAGA 1 cut(s) 215
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.