Rmu_sc0003711.1_g000001

phosphatase 2c

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003711.1
Physical Location & Seq
Forward (+)
1 .. 1909
1909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003711.1_g000001.1.cds

Sequence Viewer

Length: 1024 bp
tgtggttcaggccaattcgagccttgaggatcagggacaggtgtttacctctccctctgccacgtacgtcggcgtgtatgacggtcacggcggaccggaagcttctagattcgtcaacaataatctgttcccctttttacacaaatttgccatggaacaaggtgggttatccgaggatgtgataaggaaggcgttcagtgccactgaggaggagtttctgcgtttggtgaagcgatcgtgggcgatgaagccttcaattgcttctgtcgggtcatgttgtttggtcggggctataacaaatgatgttctgtatgttgcgaatctgggggattcgagagcagtccttggccggaaagtgaacgggagtaagaggacggtgatggcagaacggttgtcaacggatcacaatgtcagtgatgagcaggtcaggagggaagttgaagcacttcatcctgacgattcacatgttgtggtgtatactcgcggagtttggaggataaaggggataattcaggtgtcaagatctattggggatgtttatctaaagaagcctgagtttaacagagacccaatgtaccagcagtttattacccctgttcctatgaagcggccagtggtgacagcagagccctccatccttattagaaacattaagccacaggatatgtttttgatattcgcatcagatggcctatgggaacagttgagtgatgaggcagcagtagagctagtcttcaagaaccctagagcgggtattgccaagagactggtaagagctgctctccatgaagccgccaagaagagggaaatgagatatgatgacataaagaaaattgaaaagggaataaggcggcattttcatgatgatattactgtcattgtagtctatcttgatcagcacaaaagctcctcaaaacataaactcggcaacaatgctctaagttccatcacccaagcacctgttgacatttactcgcttagtgcagaggaagtagaacaggatatgcatcataccattaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

340

Amino Acids

38.18

Weight (kDa)

8.39

Isoelectric Point (pI)

46.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 413
AccBSI CCGCTC 1 cut(s) 750
AccI GTMKAC 1 cut(s) 477
AccII CGCG 1 cut(s) 484
AciI CCGC 6 cut(s) 91, 484, 608, 750, 793, 851
AclWI GGATC 2 cut(s) 37, 409
AcoI YGGCCR 2 cut(s) 347, 609
AcsI RAATTY 1 cut(s) 144
AfaI GTAC 2 cut(s) 66, 576
AfiI CCNNNNNNNGG 3 cut(s) 749, 750, 802
AflIII ACRYGT 1 cut(s) 464
AgsI TTSAA 4 cut(s) 256, 441, 737, 837
AluBI AGCT 4 cut(s) 102, 728, 777, 907
AluI AGCT 4 cut(s) 102, 728, 777, 907
Alw26I GTCTC 2 cut(s) 559, 758
AlwI GGATC 2 cut(s) 37, 409
AoxI GGCC 4 cut(s) 10, 347, 609, 689
ApeKI GCWGC 2 cut(s) 717, 777
ApoI RAATTY 1 cut(s) 144
Asp700I GAANNNNTTC 2 cut(s) 192, 445
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 4 cut(s) 239, 389, 629, 941
AvaII GGWCC 1 cut(s) 93
BanII GRGCYC 1 cut(s) 631
BbsI GAAGAC 1 cut(s) 725
BbvI GCAGC 2 cut(s) 729, 764
BccI CCATC 4 cut(s) 374, 642, 681, 954
BceAI ACGGC 1 cut(s) 104
BclI TGATCA 1 cut(s) 893
BcoDI GTCTC 2 cut(s) 559, 758
BfaI CTAG 3 cut(s) 106, 729, 745
BfuAI ACCTGC 1 cut(s) 413
BglII AGATCT 1 cut(s) 522
BisI GCNGC 5 cut(s) 609, 718, 778, 793, 852
BlsI GCNGC 5 cut(s) 610, 719, 779, 794, 853
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BmsI GCATC 2 cut(s) 690, 1016
BpiI GAAGAC 1 cut(s) 725
BplI GAGNNNNNCTC 2 cut(s) 766, 798
BpuEI CTTGAG 1 cut(s) 45
BsaAI YACGTR 1 cut(s) 64
BsaBI GATNNNNATC 2 cut(s) 538, 1006
BsaI GGTCTC 1 cut(s) 559
BsaJI CCNNGG 3 cut(s) 151, 172, 344
BsaWI WCCGGW 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 891, 921
Bsc4I CCNNNNNNNGG 3 cut(s) 749, 750, 802
Bse1I ACTGG 2 cut(s) 612, 772
Bse8I GATNNNNATC 2 cut(s) 538, 1006
BseDI CCNNGG 3 cut(s) 151, 172, 344
BseGI GGATG 4 cut(s) 182, 449, 539, 634
BseJI GATNNNNATC 2 cut(s) 538, 1006
BseLI CCNNNNNNNGG 3 cut(s) 749, 750, 802
BseMII CTCAG 2 cut(s) 196, 544
BseNI ACTGG 2 cut(s) 612, 772
BseRI GAGGAG 3 cut(s) 222, 225, 899
BseXI GCAGC 2 cut(s) 729, 764
BsgI GTGCAG 1 cut(s) 1003
Bsh1236I CGCG 1 cut(s) 484
Bsh1285I CGRYCG 1 cut(s) 237
BshFI GGCC 4 cut(s) 12, 349, 611, 691
BsiEI CGRYCG 1 cut(s) 237
BsiSI CCGG 2 cut(s) 96, 350
BsiWI CGTACG 1 cut(s) 64
BslFI GGGAC 1 cut(s) 49
BslI CCNNNNNNNGG 3 cut(s) 749, 750, 802
BsmAI GTCTC 2 cut(s) 559, 758
BsmFI GGGAC 1 cut(s) 49
BsnI GGCC 4 cut(s) 12, 349, 611, 691
Bso31I GGTCTC 1 cut(s) 559
Bsp1286I GDGCHC 1 cut(s) 631
Bsp143I GATC 5 cut(s) 29, 234, 401, 522, 893
Bsp19I CCATGG 1 cut(s) 151
BspACI CCGC 6 cut(s) 91, 484, 608, 750, 793, 851
BspANI GGCC 4 cut(s) 12, 349, 611, 691
BspCNI CTCAG 2 cut(s) 197, 545
BspFNI CGCG 1 cut(s) 484
BspHI TCATGA 1 cut(s) 860
BspMI ACCTGC 1 cut(s) 413
BspPI GGATC 2 cut(s) 37, 409
BspTNI GGTCTC 1 cut(s) 559
BsrBI CCGCTC 1 cut(s) 750
BsrI ACTGG 2 cut(s) 612, 772
BssECI CCNNGG 3 cut(s) 151, 172, 344
BssMI GATC 5 cut(s) 29, 234, 401, 522, 893
BssNAI GTATAC 1 cut(s) 478
BssT1I CCWWGG 2 cut(s) 151, 344
Bst1107I GTATAC 1 cut(s) 478
Bst4CI ACNGT 5 cut(s) 84, 377, 391, 703, 875
Bst6I CTCTTC 1 cut(s) 795
BstBAI YACGTR 1 cut(s) 64
BstDEI CTNAG 4 cut(s) 205, 553, 939, 978
BstDSI CCRYGG 1 cut(s) 151
BstF5I GGATG 4 cut(s) 182, 449, 539, 634
BstFNI CGCG 1 cut(s) 484
BstKTI GATC 5 cut(s) 32, 237, 404, 525, 896
BstMAI GTCTC 2 cut(s) 559, 758
BstMBI GATC 5 cut(s) 29, 234, 401, 522, 893
BstMCI CGRYCG 1 cut(s) 237
BstMWI GCNNNNNNNGC 2 cut(s) 198, 756
BstNSI RCATGY 1 cut(s) 468
BstUI CGCG 1 cut(s) 484
BstV1I GCAGC 2 cut(s) 729, 764
BstV2I GAAGAC 1 cut(s) 725
BstX2I RGATCY 1 cut(s) 522
BstXI CCANNNNNNTGG 1 cut(s) 767
BstYI RGATCY 1 cut(s) 522
BstZ17I GTATAC 1 cut(s) 478
BsuRI GGCC 4 cut(s) 12, 349, 611, 691
BtgI CCRYGG 1 cut(s) 151
BtgZI GCGATG 1 cut(s) 258
BtsCI GGATG 4 cut(s) 182, 449, 539, 634
BtsIMutI CAGTG 4 cut(s) 202, 203, 419, 619
BveI ACCTGC 1 cut(s) 413
CciI TCATGA 1 cut(s) 860
Cfr13I GGNCC 1 cut(s) 93
CpoI CGGWCCG 1 cut(s) 93
Csp6I GTAC 2 cut(s) 65, 575
CspI CGGWCCG 1 cut(s) 93
CviAII CATG 5 cut(s) 152, 274, 465, 786, 861
CviQI GTAC 2 cut(s) 65, 575
DdeI CTNAG 4 cut(s) 205, 553, 939, 978
DpnI GATC 5 cut(s) 31, 236, 403, 524, 895
DpnII GATC 5 cut(s) 29, 234, 401, 522, 893
EaeI YGGCCR 2 cut(s) 347, 609
Eam1104I CTCTTC 1 cut(s) 795
EarI CTCTTC 1 cut(s) 795
EciI GGCGGA 1 cut(s) 106
Eco130I CCWWGG 2 cut(s) 151, 344
Eco24I GRGCYC 1 cut(s) 631
Eco31I GGTCTC 1 cut(s) 559
Eco47I GGWCC 1 cut(s) 93
EcoT14I CCWWGG 2 cut(s) 151, 344
EcoT22I ATGCAT 1 cut(s) 1009
EcoT38I GRGCYC 1 cut(s) 631
ErhI CCWWGG 2 cut(s) 151, 344
FaeI CATG 5 cut(s) 155, 277, 468, 789, 864
FaqI GGGAC 1 cut(s) 49
FatI CATG 5 cut(s) 151, 273, 464, 785, 860
FauI CCCGC 1 cut(s) 743
FbaI TGATCA 1 cut(s) 893
FblI GTMKAC 1 cut(s) 477
Fnu4HI GCNGC 5 cut(s) 609, 718, 778, 793, 852
FokI GGATG 4 cut(s) 189, 436, 546, 621
FriOI GRGCYC 1 cut(s) 631
Fsp4HI GCNGC 5 cut(s) 609, 718, 778, 793, 852
FspBI CTAG 3 cut(s) 106, 729, 745
GluI GCNGC 5 cut(s) 609, 718, 778, 793, 852
HaeIII GGCC 4 cut(s) 12, 349, 611, 691
HapII CCGG 2 cut(s) 96, 350
Hin1II CATG 5 cut(s) 155, 277, 468, 789, 864
HincII GTYRAC 3 cut(s) 116, 397, 965
HindII GTYRAC 3 cut(s) 116, 397, 965
HindIII AAGCTT 1 cut(s) 100
HinfI GANTC 4 cut(s) 109, 320, 330, 459
HpaII CCGG 2 cut(s) 96, 350
HphI GGTGA 4 cut(s) 239, 389, 629, 941
Hpy166II GTNNAC 6 cut(s) 46, 116, 359, 397, 478, 965
Hpy188I TCNGA 2 cut(s) 173, 686
Hpy188III TCNNGA 8 cut(s) 106, 334, 428, 453, 520, 737, 861, 891
Hpy8I GTNNAC 6 cut(s) 46, 116, 359, 397, 478, 965
Hpy99I CGWCG 1 cut(s) 72
HpyAV CCTTC 2 cut(s) 182, 262
HpyCH4III ACNGT 5 cut(s) 84, 377, 391, 703, 875
HpyCH4IV ACGT 2 cut(s) 63, 67
HpyCH4V TGCA 2 cut(s) 984, 1007
HpyF10VI GCNNNNNNNGC 2 cut(s) 198, 756
HpyF3I CTNAG 4 cut(s) 205, 553, 939, 978
HpySE526I ACGT 2 cut(s) 63, 67
Hsp92II CATG 5 cut(s) 155, 277, 468, 789, 864
Ksp22I TGATCA 1 cut(s) 893
Kzo9I GATC 5 cut(s) 29, 234, 401, 522, 893
LmnI GCTCC 1 cut(s) 912
Lsp1109I GCAGC 2 cut(s) 729, 764
LweI GCATC 2 cut(s) 690, 1016
MaeI CTAG 3 cut(s) 106, 729, 745
MaeII ACGT 2 cut(s) 63, 67
MaeIII GTNAC 2 cut(s) 84, 617
MalI GATC 5 cut(s) 31, 236, 403, 524, 895
MbiI CCGCTC 1 cut(s) 750
MboI GATC 5 cut(s) 29, 234, 401, 522, 893
MboII GAAGA 2 cut(s) 725, 812
MfeI CAATTG 1 cut(s) 256
MflI RGATCY 1 cut(s) 522
MhlI GDGCHC 1 cut(s) 631
MluCI AATT 5 cut(s) 14, 144, 256, 508, 832
Mph1103I ATGCAT 1 cut(s) 1009
MroXI GAANNNNTTC 2 cut(s) 192, 445
MseI TTAA 3 cut(s) 559, 652, 1018
MslI CAYNNNNRTG 1 cut(s) 859
MspI CCGG 2 cut(s) 96, 350
MunI CAATTG 1 cut(s) 256
MvnI CGCG 1 cut(s) 484
MwoI GCNNNNNNNGC 2 cut(s) 198, 756
NcoI CCATGG 1 cut(s) 151
NdeII GATC 5 cut(s) 29, 234, 401, 522, 893
NlaIII CATG 5 cut(s) 155, 277, 468, 789, 864
NmeAIII GCCGAG 1 cut(s) 904
NmuCI GTSAC 2 cut(s) 84, 617
NsiI ATGCAT 1 cut(s) 1009
NspI RCATGY 1 cut(s) 468
PagI TCATGA 1 cut(s) 860
PciI ACATGT 1 cut(s) 464
PdmI GAANNNNTTC 2 cut(s) 192, 445
PfeI GAWTC 4 cut(s) 109, 320, 330, 459
Pfl23II CGTACG 1 cut(s) 64
PkrI GCNGC 5 cut(s) 610, 719, 779, 794, 853
Ple19I CGATCG 1 cut(s) 237
Ppu21I YACGTR 1 cut(s) 64
PscI ACATGT 1 cut(s) 464
PspLI CGTACG 1 cut(s) 64
PspPI GGNCC 1 cut(s) 93
PsuI RGATCY 1 cut(s) 522
PvuI CGATCG 1 cut(s) 237
RsaI GTAC 2 cut(s) 66, 576
RsaNI GTAC 2 cut(s) 65, 575
RseI CAYNNNNRTG 1 cut(s) 859
Rsr2I CGGWCCG 1 cut(s) 93
RsrII CGGWCCG 1 cut(s) 93
SaqAI TTAA 3 cut(s) 559, 652, 1018
SatI GCNGC 5 cut(s) 609, 718, 778, 793, 852
Sau3AI GATC 5 cut(s) 29, 234, 401, 522, 893
Sau96I GGNCC 1 cut(s) 93
SduI GDGCHC 1 cut(s) 631
SfaNI GCATC 2 cut(s) 690, 1016
SinI GGWCC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 859
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
Sse9I AATT 5 cut(s) 14, 144, 256, 508, 832
SsiI CCGC 6 cut(s) 91, 484, 608, 750, 793, 851
SspMI CTAG 3 cut(s) 106, 729, 745
StyI CCWWGG 2 cut(s) 151, 344
TaaI ACNGT 5 cut(s) 84, 377, 391, 703, 875
TaiI ACGT 2 cut(s) 66, 70
TaqI TCGA 2 cut(s) 18, 333
TasI AATT 5 cut(s) 14, 144, 256, 508, 832
TauI GCSGC 3 cut(s) 611, 795, 854
TfiI GAWTC 4 cut(s) 109, 320, 330, 459
Tru1I TTAA 3 cut(s) 559, 652, 1018
Tru9I TTAA 3 cut(s) 559, 652, 1018
TscAI CASTG 4 cut(s) 203, 209, 419, 619
TseFI GTSAC 2 cut(s) 84, 617
TseI GCWGC 2 cut(s) 717, 777
Tsp45I GTSAC 2 cut(s) 84, 617
TspDTI ATGAA 5 cut(s) 261, 438, 618, 802, 849
TspGWI ACGGA 1 cut(s) 414
TspRI CASTG 4 cut(s) 203, 209, 419, 619
VpaK11BI GGWCC 1 cut(s) 93
XapI RAATTY 1 cut(s) 144
XbaI TCTAGA 1 cut(s) 105
XceI RCATGY 1 cut(s) 468
XmiI GTMKAC 1 cut(s) 477
XmnI GAANNNNTTC 2 cut(s) 192, 445
XspI CTAG 3 cut(s) 106, 729, 745
Zsp2I ATGCAT 1 cut(s) 1009
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.