Rmu_co8099568.1_g000001

CHD3-type chromatin-remodeling factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8099568.1
Physical Location & Seq
Forward (+)
220 .. 600
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8099568.1_g000001.1.cds

Sequence Viewer

Length: 223 bp
atggtatctgttgaagaagatgatcttgctggtttggaagatgtaagttctgatggagaggatgataactatgaagctgaagtgacggatggcgaaacagcttcctctgcacctctttctggaactctttctgggagaaagcctaataaaaagagaagtcgtgtggatagtgcagaaccccctcctttgatggaaggagaaggaagatcattcaaagtcttgg

Protein Analysis

74

Amino Acids

7.86

Weight (kDa)

4.19

Isoelectric Point (pI)

49.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 14, 214
AluBI AGCT 2 cut(s) 77, 101
AluI AGCT 2 cut(s) 77, 101
Asp700I GAANNNNTTC 1 cut(s) 127
BccI CCATC 3 cut(s) 47, 83, 184
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseGI GGATG 2 cut(s) 67, 94
BseLI CCNNNNNNNGG 1 cut(s) 119
BsgI GTGCAG 2 cut(s) 93, 192
BslI CCNNNNNNNGG 1 cut(s) 119
Bsp143I GATC 2 cut(s) 22, 206
BssMI GATC 2 cut(s) 22, 206
BstF5I GGATG 2 cut(s) 67, 94
BstKTI GATC 2 cut(s) 25, 209
BstMBI GATC 2 cut(s) 22, 206
BstMWI GCNNNNNNNGC 1 cut(s) 107
BtsCI GGATG 2 cut(s) 67, 94
CviJI RGCY 3 cut(s) 77, 101, 142
CviKI_1 RGCY 3 cut(s) 77, 101, 142
DpnI GATC 2 cut(s) 24, 208
DpnII GATC 2 cut(s) 22, 206
Eco57I CTGAAG 1 cut(s) 99
FaiI YATR 1 cut(s) 72
FalI AAGNNNNNCTT 2 cut(s) 9, 41
FokI GGATG 2 cut(s) 74, 101
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 120
HpyAV CCTTC 2 cut(s) 188, 194
HpyCH4V TGCA 2 cut(s) 110, 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Kzo9I GATC 2 cut(s) 22, 206
LpnPI CCDG 3 cut(s) 15, 105, 117
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 24, 208
MboI GATC 2 cut(s) 22, 206
MboII GAAGA 4 cut(s) 26, 29, 50, 216
MnlI CCTC 4 cut(s) 52, 115, 123, 192
MroXI GAANNNNTTC 1 cut(s) 127
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 2 cut(s) 22, 206
NmuCI GTSAC 1 cut(s) 82
PdmI GAANNNNTTC 1 cut(s) 127
Sau3AI GATC 2 cut(s) 22, 206
SetI ASST 3 cut(s) 79, 103, 115
SgeI CNNG 5 cut(s) 38, 42, 132, 144, 173
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 87
TspGWI ACGGA 1 cut(s) 101
XmnI GAANNNNTTC 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.