Rmu_sc0024262.1_g000001

CHD3-type chromatin-remodeling factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024262.1
Physical Location & Seq
Forward (+)
1 .. 731
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024262.1_g000001.1.cds

Sequence Viewer

Length: 248 bp
ttgaacaaccattaacagactccccaaccttttcagatggtgtccctaaagaaggactcaggatacaagacgtacttgttcggatttctgttatgtctatgattcatcagaaagcaaagtttgcaacagaaaatccaggcgctcctttgtatgaagatgacatcatgttccgttacccaggactgaagggtagcaaatattggaaggagtatcatgatggaatattactgcgtgccgtattaaagtaa

Protein Analysis

81

Amino Acids

9.24

Weight (kDa)

7.02

Isoelectric Point (pI)

44.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 205
AfaI GTAC 1 cut(s) 74
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 4
AjnI CCWGG 2 cut(s) 135, 177
AspLEI GCGC 1 cut(s) 142
BccI CCATC 2 cut(s) 31, 211
BceAI ACGGC 1 cut(s) 220
BciT130I CCWGG 2 cut(s) 137, 179
BciVI GTATCC 1 cut(s) 56
BfoI RGCGCY 1 cut(s) 143
BfuI GTATCC 1 cut(s) 56
Bme1390I CCNGG 2 cut(s) 137, 179
BmrFI CCNGG 2 cut(s) 137, 179
BsaJI CCNNGG 1 cut(s) 177
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseBI CCWGG 2 cut(s) 137, 179
BseDI CCNNGG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 72
BslFI GGGAC 1 cut(s) 28
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 71
BspHI TCATGA 1 cut(s) 213
BssECI CCNNGG 1 cut(s) 177
Bst2UI CCWGG 2 cut(s) 137, 179
BstAPI GCANNNNNTGC 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 58
BstENI CCTNNNNNAGG 1 cut(s) 50
BstH2I RGCGCY 1 cut(s) 143
BstHHI GCGC 1 cut(s) 142
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 2 cut(s) 137, 179
BstSCI CCNGG 2 cut(s) 135, 177
BsuI GTATCC 1 cut(s) 56
Cac8I GCNNGC 1 cut(s) 233
CciI TCATGA 1 cut(s) 213
CfoI GCGC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 73
CviAII CATG 2 cut(s) 165, 214
CviQI GTAC 1 cut(s) 73
DdeI CTNAG 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 205
EcoNI CCTNNNNNAGG 1 cut(s) 50
EcoRII CCWGG 2 cut(s) 135, 177
FaeI CATG 2 cut(s) 168, 217
FaiI YATR 5 cut(s) 94, 100, 152, 166, 215
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FaqI GGGAC 1 cut(s) 28
FatI CATG 2 cut(s) 164, 213
GlaI GCGC 1 cut(s) 141
HaeII RGCGCY 1 cut(s) 143
HhaI GCGC 1 cut(s) 142
Hin1II CATG 2 cut(s) 168, 217
Hin6I GCGC 1 cut(s) 140
HinP1I GCGC 1 cut(s) 140
HinfI GANTC 3 cut(s) 19, 56, 102
Hpy188I TCNGA 3 cut(s) 36, 83, 110
Hpy188III TCNNGA 2 cut(s) 60, 214
HpyAV CCTTC 3 cut(s) 46, 180, 198
HpyCH4IV ACGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 1 cut(s) 58
HpySE526I ACGT 1 cut(s) 71
Hsp92II CATG 2 cut(s) 168, 217
HspAI GCGC 1 cut(s) 140
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 5 cut(s) 45, 122, 149, 164, 191
MaeII ACGT 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 172
MboII GAAGA 1 cut(s) 166
MlyI GAGTC 2 cut(s) 13, 50
MseI TTAA 2 cut(s) 13, 241
MspR9I CCNGG 2 cut(s) 137, 179
MvaI CCWGG 2 cut(s) 137, 179
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 2 cut(s) 168, 217
PagI TCATGA 1 cut(s) 213
PfeI GAWTC 1 cut(s) 102
PleI GAGTC 2 cut(s) 13, 50
PpsI GAGTC 2 cut(s) 13, 50
Psp6I CCWGG 2 cut(s) 135, 177
PspGI CCWGG 2 cut(s) 135, 177
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 13, 241
SchI GAGTC 2 cut(s) 13, 50
ScrFI CCNGG 2 cut(s) 137, 179
SetI ASST 2 cut(s) 31, 74
SspI AATATT 2 cut(s) 199, 224
StyD4I CCNGG 2 cut(s) 135, 177
TaiI ACGT 1 cut(s) 74
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 2 cut(s) 13, 241
Tru9I TTAA 2 cut(s) 13, 241
TspDTI ATGAA 2 cut(s) 94, 167
TspGWI ACGGA 1 cut(s) 160
XagI CCTNNNNNAGG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.