Rmu_co8375563.1_g000001

Catalyzes the prenylation of para-hydroxybenzoate (PHB) with an all-trans polyprenyl group. Mediates the second step in the final reaction sequence of coenzyme Q (CoQ) biosynthesis, which is the condensation of the polyisoprenoid side chain with PHB, generating the first membrane-bound Q intermediate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8375563.1
OG0001284
Physical Location & Seq
Forward (+)
1 .. 907
907 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8375563.1_g000001.1.cds

Sequence Viewer

Length: 399 bp
cctcaagcatacctaggtttgacctttaactggggagctttgttaggatgggctgcaattaaaggaagcattgatccagctatagtagttccgttgtacatttctggagtattttggacacttgtgtatgatacgatatatgcgcatcaggataaagaagatgatctgaaggttggtgtcaaatctaccgctttgaggtttggtgattcaacaaaggagtggattactgggtttggaatcctgtgcatcagtagtcttgccctcagtggatataatgccgaaattggctggccatattatgcacttttggcagtcgcatctggacaattagcttggcagatatggacagttgacctttcatccaggcttgattgcaatagaaagtatgtatcattgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00130 ko01100 ko01110 map00130 map01100 map01110
Pfam Domains
Protein Families
UbiA

Protein Analysis

132

Amino Acids

14.57

Weight (kDa)

5.14

Isoelectric Point (pI)

19.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 144
AciI CCGC 1 cut(s) 189
AclWI GGATC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 290
AcuI CTGAAG 1 cut(s) 188
AfaI GTAC 1 cut(s) 98
AfiI CCNNNNNNNGG 2 cut(s) 30, 195
AgsI TTSAA 1 cut(s) 210
AjnI CCWGG 1 cut(s) 362
AluBI AGCT 3 cut(s) 38, 80, 332
AluI AGCT 3 cut(s) 38, 80, 332
AlwI GGATC 1 cut(s) 68
AoxI GGCC 1 cut(s) 290
ApeKI GCWGC 1 cut(s) 53
AspA2I CCTAGG 1 cut(s) 13
AspLEI GCGC 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 215
AvrII CCTAGG 1 cut(s) 13
BalI TGGCCA 1 cut(s) 292
BbvI GCAGC 1 cut(s) 40
BccI CCATC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 364
BfaI CTAG 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 81
BisI GCNGC 1 cut(s) 54
BlnI CCTAGG 1 cut(s) 13
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 364
BmrFI CCNGG 1 cut(s) 364
BmrI ACTGGG 2 cut(s) 40, 237
BmsI GCATC 3 cut(s) 154, 255, 326
BmuI ACTGGG 2 cut(s) 40, 237
BpmI CTGGAG 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 13
Bsc4I CCNNNNNNNGG 2 cut(s) 30, 195
Bse1I ACTGG 2 cut(s) 35, 232
BseBI CCWGG 1 cut(s) 364
BseDI CCNNGG 1 cut(s) 13
BseGI GGATG 2 cut(s) 53, 359
BseLI CCNNNNNNNGG 2 cut(s) 30, 195
BseMII CTCAG 1 cut(s) 277
BseNI ACTGG 2 cut(s) 35, 232
BseXI GCAGC 1 cut(s) 40
BshFI GGCC 1 cut(s) 292
BslI CCNNNNNNNGG 2 cut(s) 30, 195
BsnI GGCC 1 cut(s) 292
Bsp1407I TGTACA 1 cut(s) 96
Bsp143I GATC 2 cut(s) 73, 163
BspACI CCGC 1 cut(s) 189
BspANI GGCC 1 cut(s) 292
BspCNI CTCAG 1 cut(s) 276
BspPI GGATC 1 cut(s) 68
BsrGI TGTACA 1 cut(s) 96
BsrI ACTGG 2 cut(s) 35, 232
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 2 cut(s) 73, 163
BssT1I CCWWGG 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 364
Bst4CI ACNGT 1 cut(s) 349
BstAUI TGTACA 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 290
BstDEI CTNAG 1 cut(s) 263
BstF5I GGATG 2 cut(s) 53, 359
BstHHI GCGC 1 cut(s) 145
BstKTI GATC 2 cut(s) 76, 166
BstMBI GATC 2 cut(s) 73, 163
BstMWI GCNNNNNNNGC 1 cut(s) 308
BstNI CCWGG 1 cut(s) 364
BstSCI CCNGG 1 cut(s) 362
BstSFI CTRYAG 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 292
BtsCI GGATG 2 cut(s) 53, 359
BtsIMutI CAGTG 1 cut(s) 271
Cac8I GCNNGC 1 cut(s) 290
CfoI GCGC 1 cut(s) 145
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 7 cut(s) 38, 53, 80, 288, 292, 332, 367
CviKI_1 RGCY 7 cut(s) 38, 53, 80, 288, 292, 332, 367
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 263
DpnI GATC 2 cut(s) 75, 165
DpnII GATC 2 cut(s) 73, 163
EaeI YGGCCR 1 cut(s) 290
Eco130I CCWWGG 1 cut(s) 13
Eco57I CTGAAG 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 362
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 2 cut(s) 60, 346
Fsp4HI GCNGC 1 cut(s) 54
FspAI RTGCGCAY 1 cut(s) 144
FspBI CTAG 1 cut(s) 14
FspI TGCGCA 1 cut(s) 144
GlaI GCGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 54
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 292
HhaI GCGC 1 cut(s) 145
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HincII GTYRAC 1 cut(s) 352
HindII GTYRAC 1 cut(s) 352
HinfI GANTC 2 cut(s) 206, 237
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 352
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 3 cut(s) 105, 149, 321
Hpy8I GTNNAC 1 cut(s) 352
HpyAV CCTTC 1 cut(s) 163
HpyCH4III ACNGT 1 cut(s) 349
HpyCH4V TGCA 4 cut(s) 56, 246, 302, 375
HpyF10VI GCNNNNNNNGC 1 cut(s) 308
HpyF3I CTNAG 1 cut(s) 263
HspAI GCGC 1 cut(s) 143
Kzo9I GATC 2 cut(s) 73, 163
LmnI GCTCC 1 cut(s) 35
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 3 cut(s) 154, 255, 326
MaeI CTAG 1 cut(s) 14
MalI GATC 2 cut(s) 75, 165
MboI GATC 2 cut(s) 73, 163
MboII GAAGA 1 cut(s) 170
MlsI TGGCCA 1 cut(s) 292
MluCI AATT 3 cut(s) 57, 282, 326
MluNI TGGCCA 1 cut(s) 292
MnlI CCTC 3 cut(s) 12, 189, 272
Mox20I TGGCCA 1 cut(s) 292
MscI TGGCCA 1 cut(s) 292
MseI TTAA 2 cut(s) 27, 60
Msp20I TGGCCA 1 cut(s) 292
MspR9I CCNGG 1 cut(s) 364
MvaI CCWGG 1 cut(s) 364
MwoI GCNNNNNNNGC 1 cut(s) 308
NdeII GATC 2 cut(s) 73, 163
NsbI TGCGCA 1 cut(s) 144
PfeI GAWTC 2 cut(s) 206, 237
PkrI GCNGC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 362
PspGI CCWGG 1 cut(s) 362
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 27, 60
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 73, 163
ScrFI CCNGG 1 cut(s) 364
SetI ASST 9 cut(s) 15, 19, 26, 40, 82, 174, 200, 334, 357
SfaNI GCATC 3 cut(s) 154, 255, 326
SfcI CTRYAG 1 cut(s) 81
SmlI CTYRAG 1 cut(s) 3
SmoI CTYRAG 1 cut(s) 3
Sse9I AATT 3 cut(s) 57, 282, 326
SsiI CCGC 1 cut(s) 189
SspMI CTAG 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 362
StyI CCWWGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 349
TasI AATT 3 cut(s) 57, 282, 326
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 2 cut(s) 206, 237
Tru1I TTAA 2 cut(s) 27, 60
Tru9I TTAA 2 cut(s) 27, 60
TscAI CASTG 1 cut(s) 271
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 348
TspGWI ACGGA 1 cut(s) 81
TspRI CASTG 1 cut(s) 271
XmaJI CCTAGG 1 cut(s) 13
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.