Rmu_sc0018477.1_g000004

Catalyzes the prenylation of para-hydroxybenzoate (PHB) with an all-trans polyprenyl group. Mediates the second step in the final reaction sequence of coenzyme Q (CoQ) biosynthesis, which is the condensation of the polyisoprenoid side chain with PHB, generating the first membrane-bound Q intermediate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018477.1
OG0001284
Physical Location & Seq
Forward (+)
23124 .. 24371
1248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018477.1_g000004.1.cds

Sequence Viewer

Length: 474 bp
atgaaaaggttgacattctggcctcaagcatacctaggtttgacctttaactggggagctttgttaggatgggctgcaattaaagggagcattgatccagctatagtacttccattgtacatttctggagtattttggacacttgtgtatgatacgatatatgcacatcaggataaagaagatgatctgaagattggtgtcaaatctaccgctttgaagtttggtgattcaacaaaggagtggattactgggtttggaatcctgtgcatcagtagtcttgccctcagtggatatattgccgaaattggctggccatattatgcacttctagcagttgcatctggacaattagcttggcagatatggacggttgacctttcatctaggcttgattgcaatagaaagtttgtgtcgaacaagtggtttggtgctattatttgcagtggaatcttattgggaagactttcatcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00130 ko01100 ko01110 map00130 map01100 map01110
Pfam Domains
Protein Families
UbiA

Protein Analysis

157

Amino Acids

17.42

Weight (kDa)

8.42

Isoelectric Point (pI)

22.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 210
AclWI GGATC 1 cut(s) 89
AcoI YGGCCR 1 cut(s) 311
AcuI CTGAAG 1 cut(s) 209
AfaI GTAC 2 cut(s) 108, 119
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 2 cut(s) 217, 231
AluBI AGCT 3 cut(s) 59, 101, 353
AluI AGCT 3 cut(s) 59, 101, 353
AlwI GGATC 1 cut(s) 89
AoxI GGCC 2 cut(s) 20, 311
ApeKI GCWGC 1 cut(s) 74
Asp700I GAANNNNTTC 1 cut(s) 463
AspA2I CCTAGG 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 236
AvrII CCTAGG 1 cut(s) 34
BalI TGGCCA 1 cut(s) 313
BbsI GAAGAC 1 cut(s) 466
BbvI GCAGC 1 cut(s) 61
BccI CCATC 1 cut(s) 63
BfaI CTAG 3 cut(s) 35, 329, 384
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 1 cut(s) 75
BlnI CCTAGG 1 cut(s) 34
BlsI GCNGC 1 cut(s) 76
BmcAI AGTACT 1 cut(s) 108
BmrI ACTGGG 2 cut(s) 61, 258
BmsI GCATC 2 cut(s) 276, 347
BmuI ACTGGG 2 cut(s) 61, 258
BpiI GAAGAC 1 cut(s) 466
BpmI CTGGAG 1 cut(s) 147
BpuEI CTTGAG 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 51
Bse1I ACTGG 2 cut(s) 56, 253
BseDI CCNNGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 298
BseNI ACTGG 2 cut(s) 56, 253
BseXI GCAGC 1 cut(s) 61
BshFI GGCC 2 cut(s) 22, 313
BslI CCNNNNNNNGG 1 cut(s) 51
BsnI GGCC 2 cut(s) 22, 313
Bsp1407I TGTACA 1 cut(s) 117
Bsp143I GATC 2 cut(s) 94, 184
BspACI CCGC 1 cut(s) 210
BspANI GGCC 2 cut(s) 22, 313
BspCNI CTCAG 1 cut(s) 297
BspPI GGATC 1 cut(s) 89
BsrGI TGTACA 1 cut(s) 117
BsrI ACTGG 2 cut(s) 56, 253
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 2 cut(s) 94, 184
BssT1I CCWWGG 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 370
BstAUI TGTACA 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 311
BstDEI CTNAG 1 cut(s) 284
BstF5I GGATG 1 cut(s) 74
BstKTI GATC 2 cut(s) 97, 187
BstMBI GATC 2 cut(s) 94, 184
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 61
BstV2I GAAGAC 1 cut(s) 466
BsuRI GGCC 2 cut(s) 22, 313
BtsCI GGATG 1 cut(s) 74
BtsI GCAGTG 1 cut(s) 448
BtsIMutI CAGTG 2 cut(s) 292, 448
Cac8I GCNNGC 1 cut(s) 311
Csp6I GTAC 2 cut(s) 107, 118
CviJI RGCY 8 cut(s) 22, 59, 74, 101, 309, 313, 353, 388
CviKI_1 RGCY 8 cut(s) 22, 59, 74, 101, 309, 313, 353, 388
CviQI GTAC 2 cut(s) 107, 118
DdeI CTNAG 1 cut(s) 284
DpnI GATC 2 cut(s) 96, 186
DpnII GATC 2 cut(s) 94, 184
EaeI YGGCCR 1 cut(s) 311
Eco130I CCWWGG 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 209
EcoT14I CCWWGG 1 cut(s) 34
ErhI CCWWGG 1 cut(s) 34
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 75
FspBI CTAG 3 cut(s) 35, 329, 384
GluI GCNGC 1 cut(s) 75
GsuI CTGGAG 1 cut(s) 147
HaeIII GGCC 2 cut(s) 22, 313
HincII GTYRAC 2 cut(s) 12, 373
HindII GTYRAC 2 cut(s) 12, 373
HinfI GANTC 3 cut(s) 227, 258, 447
HphI GGTGA 1 cut(s) 236
Hpy166II GTNNAC 2 cut(s) 12, 373
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 3 cut(s) 126, 170, 342
Hpy8I GTNNAC 2 cut(s) 12, 373
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 7 cut(s) 77, 164, 267, 323, 338, 396, 441
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpyF3I CTNAG 1 cut(s) 284
Kzo9I GATC 2 cut(s) 94, 184
LmnI GCTCC 2 cut(s) 56, 87
LpnPI CCDG 9 cut(s) 4, 37, 111, 111, 155, 234, 275, 295, 327
Lsp1109I GCAGC 1 cut(s) 61
LweI GCATC 2 cut(s) 276, 347
MaeI CTAG 3 cut(s) 35, 329, 384
MalI GATC 2 cut(s) 96, 186
MboI GATC 2 cut(s) 94, 184
MboII GAAGA 3 cut(s) 191, 202, 471
MlsI TGGCCA 1 cut(s) 313
MluCI AATT 3 cut(s) 78, 303, 347
MluNI TGGCCA 1 cut(s) 313
MnlI CCTC 2 cut(s) 33, 293
Mox20I TGGCCA 1 cut(s) 313
MroXI GAANNNNTTC 1 cut(s) 463
MscI TGGCCA 1 cut(s) 313
MseI TTAA 2 cut(s) 48, 81
Msp20I TGGCCA 1 cut(s) 313
MwoI GCNNNNNNNGC 1 cut(s) 329
NdeII GATC 2 cut(s) 94, 184
PdmI GAANNNNTTC 1 cut(s) 463
PfeI GAWTC 3 cut(s) 227, 258, 447
PkrI GCNGC 1 cut(s) 76
RsaI GTAC 2 cut(s) 108, 119
RsaNI GTAC 2 cut(s) 107, 118
SaqAI TTAA 2 cut(s) 48, 81
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 2 cut(s) 94, 184
ScaI AGTACT 1 cut(s) 108
SetI ASST 8 cut(s) 11, 36, 40, 47, 61, 103, 355, 378
SfaNI GCATC 2 cut(s) 276, 347
SfcI CTRYAG 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
Sse9I AATT 3 cut(s) 78, 303, 347
SsiI CCGC 1 cut(s) 210
SspMI CTAG 3 cut(s) 35, 329, 384
StyI CCWWGG 1 cut(s) 34
TaaI ACNGT 1 cut(s) 370
TaqI TCGA 1 cut(s) 413
TasI AATT 3 cut(s) 78, 303, 347
TatI WGTACW 2 cut(s) 106, 117
TfiI GAWTC 3 cut(s) 227, 258, 447
Tru1I TTAA 2 cut(s) 48, 81
Tru9I TTAA 2 cut(s) 48, 81
TscAI CASTG 2 cut(s) 292, 448
TseI GCWGC 1 cut(s) 74
TspDTI ATGAA 3 cut(s) 17, 369, 456
TspRI CASTG 2 cut(s) 292, 448
XmaJI CCTAGG 1 cut(s) 34
XmnI GAANNNNTTC 1 cut(s) 463
XspI CTAG 3 cut(s) 35, 329, 384
ZrmI AGTACT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.