Rmu_ssc0000144.1_g000005

Catalyzes the prenylation of para-hydroxybenzoate (PHB) with an all-trans polyprenyl group. Mediates the second step in the final reaction sequence of coenzyme Q (CoQ) biosynthesis, which is the condensation of the polyisoprenoid side chain with PHB, generating the first membrane-bound Q intermediate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000144.1
Physical Location & Seq
Forward (+)
28874 .. 30069
1196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000144.1_g000005.1.cds

Sequence Viewer

Length: 474 bp
atgaaaaggttgacattctggcctcaagcataccttggtttgacctttaactggggagctttgttaggatgggctgcaatcaaaggaagcattgatccagctatagtactcccattgtacatttctggcgtattttggacacttgtgtatgatacgatatatgcacatcaggataaagaagatgatctgaaggttggtgtcaaatctaccgctttgaggtttggtgattcaacaaaggaagggattactgggtttggaatcctatgcatcagtagtcttgcgctcagtggatataatgccgaaattggctggccatattatgcacttttggcagttgcatctggacaattagcttggcagatatggacagttgacctttcatccaggcttgattgcaatggaaagtttgtgtcgaacaagtggtttggtgctattatttgcagtgcaatattattgggaagactgccatcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

157

Amino Acids

17.23

Weight (kDa)

7.67

Isoelectric Point (pI)

24.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 210
AclWI GGATC 1 cut(s) 89
AcoI YGGCCR 1 cut(s) 311
AcuI CTGAAG 1 cut(s) 209
AfaI GTAC 2 cut(s) 108, 119
AfiI CCNNNNNNNGG 2 cut(s) 51, 216
AgsI TTSAA 1 cut(s) 231
AjnI CCWGG 1 cut(s) 383
AluBI AGCT 3 cut(s) 59, 101, 353
AluI AGCT 3 cut(s) 59, 101, 353
AlwI GGATC 1 cut(s) 89
AoxI GGCC 2 cut(s) 20, 311
ApeKI GCWGC 1 cut(s) 74
AspLEI GCGC 1 cut(s) 283
AsuHPI GGTGA 1 cut(s) 236
BalI TGGCCA 1 cut(s) 313
BbsI GAAGAC 1 cut(s) 466
BbvI GCAGC 1 cut(s) 61
BccI CCATC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 385
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
BmcAI AGTACT 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 385
BmrFI CCNGG 1 cut(s) 385
BmrI ACTGGG 2 cut(s) 61, 258
BmsI GCATC 2 cut(s) 276, 347
BmuI ACTGGG 2 cut(s) 61, 258
BpiI GAAGAC 1 cut(s) 466
BpuEI CTTGAG 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 216
Bse1I ACTGG 2 cut(s) 56, 253
Bse3DI GCAATG 1 cut(s) 403
BseBI CCWGG 1 cut(s) 385
BseDI CCNNGG 1 cut(s) 34
BseGI GGATG 2 cut(s) 74, 380
BseLI CCNNNNNNNGG 2 cut(s) 51, 216
BseMI GCAATG 1 cut(s) 403
BseMII CTCAG 1 cut(s) 298
BseNI ACTGG 2 cut(s) 56, 253
BseXI GCAGC 1 cut(s) 61
BshFI GGCC 2 cut(s) 22, 313
BslI CCNNNNNNNGG 2 cut(s) 51, 216
BsnI GGCC 2 cut(s) 22, 313
Bsp1407I TGTACA 1 cut(s) 117
Bsp143I GATC 2 cut(s) 94, 184
BspACI CCGC 1 cut(s) 210
BspANI GGCC 2 cut(s) 22, 313
BspCNI CTCAG 1 cut(s) 297
BspPI GGATC 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 403
BsrGI TGTACA 1 cut(s) 117
BsrI ACTGG 2 cut(s) 56, 253
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 2 cut(s) 94, 184
BssT1I CCWWGG 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 385
Bst4CI ACNGT 1 cut(s) 370
BstAUI TGTACA 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 311
BstDEI CTNAG 1 cut(s) 284
BstF5I GGATG 2 cut(s) 74, 380
BstHHI GCGC 1 cut(s) 283
BstKTI GATC 2 cut(s) 97, 187
BstMBI GATC 2 cut(s) 94, 184
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstNI CCWGG 1 cut(s) 385
BstSCI CCNGG 1 cut(s) 383
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 61
BstV2I GAAGAC 1 cut(s) 466
BsuRI GGCC 2 cut(s) 22, 313
BtsCI GGATG 2 cut(s) 74, 380
BtsI GCAGTG 1 cut(s) 448
BtsIMutI CAGTG 2 cut(s) 292, 448
Cac8I GCNNGC 1 cut(s) 311
CfoI GCGC 1 cut(s) 283
Csp6I GTAC 2 cut(s) 107, 118
CviJI RGCY 8 cut(s) 22, 59, 74, 101, 309, 313, 353, 388
CviKI_1 RGCY 8 cut(s) 22, 59, 74, 101, 309, 313, 353, 388
CviQI GTAC 2 cut(s) 107, 118
DdeI CTNAG 1 cut(s) 284
DpnI GATC 2 cut(s) 96, 186
DpnII GATC 2 cut(s) 94, 184
EaeI YGGCCR 1 cut(s) 311
Eco130I CCWWGG 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 383
EcoT14I CCWWGG 1 cut(s) 34
EcoT22I ATGCAT 1 cut(s) 269
ErhI CCWWGG 1 cut(s) 34
FalI AAGNNNNNCTT 2 cut(s) 18, 50
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 2 cut(s) 81, 367
Fsp4HI GCNGC 1 cut(s) 75
GlaI GCGC 1 cut(s) 282
GluI GCNGC 1 cut(s) 75
HaeIII GGCC 2 cut(s) 22, 313
HhaI GCGC 1 cut(s) 283
Hin6I GCGC 1 cut(s) 281
HinP1I GCGC 1 cut(s) 281
HincII GTYRAC 2 cut(s) 12, 373
HindII GTYRAC 2 cut(s) 12, 373
HinfI GANTC 2 cut(s) 227, 258
HphI GGTGA 1 cut(s) 236
Hpy166II GTNNAC 2 cut(s) 12, 373
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 170, 342
Hpy8I GTNNAC 2 cut(s) 12, 373
HpyAV CCTTC 2 cut(s) 184, 233
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 8 cut(s) 77, 164, 267, 323, 338, 396, 441, 446
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpyF3I CTNAG 1 cut(s) 284
HspAI GCGC 1 cut(s) 281
Kzo9I GATC 2 cut(s) 94, 184
LmnI GCTCC 1 cut(s) 56
Lsp1109I GCAGC 1 cut(s) 61
LweI GCATC 2 cut(s) 276, 347
MalI GATC 2 cut(s) 96, 186
MboI GATC 2 cut(s) 94, 184
MboII GAAGA 2 cut(s) 191, 471
MlsI TGGCCA 1 cut(s) 313
MluCI AATT 2 cut(s) 303, 347
MluNI TGGCCA 1 cut(s) 313
MnlI CCTC 2 cut(s) 33, 210
Mox20I TGGCCA 1 cut(s) 313
Mph1103I ATGCAT 1 cut(s) 269
MscI TGGCCA 1 cut(s) 313
MseI TTAA 1 cut(s) 48
Msp20I TGGCCA 1 cut(s) 313
MspR9I CCNGG 1 cut(s) 385
MvaI CCWGG 1 cut(s) 385
MwoI GCNNNNNNNGC 1 cut(s) 329
NdeII GATC 2 cut(s) 94, 184
NsiI ATGCAT 1 cut(s) 269
PfeI GAWTC 2 cut(s) 227, 258
PkrI GCNGC 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 383
PspGI CCWGG 1 cut(s) 383
RsaI GTAC 2 cut(s) 108, 119
RsaNI GTAC 2 cut(s) 107, 118
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 2 cut(s) 94, 184
ScaI AGTACT 1 cut(s) 108
ScrFI CCNGG 1 cut(s) 385
SetI ASST 9 cut(s) 11, 36, 47, 61, 103, 195, 221, 355, 378
SfaNI GCATC 2 cut(s) 276, 347
SfcI CTRYAG 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
Sse9I AATT 2 cut(s) 303, 347
SsiI CCGC 1 cut(s) 210
SspI AATATT 1 cut(s) 450
StyD4I CCNGG 1 cut(s) 383
StyI CCWWGG 1 cut(s) 34
TaaI ACNGT 1 cut(s) 370
TaqI TCGA 1 cut(s) 413
TasI AATT 2 cut(s) 303, 347
TatI WGTACW 2 cut(s) 106, 117
TfiI GAWTC 2 cut(s) 227, 258
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 2 cut(s) 292, 448
TseI GCWGC 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 17, 369
TspRI CASTG 2 cut(s) 292, 448
ZrmI AGTACT 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.