Rmu_sc0000431.1_g000021

pcf11p-similar protein 4

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000431.1
Physical Location & Seq
Reverse (-)
131089 .. 131845
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000431.1_g000021.1.cds

Sequence Viewer

Length: 639 bp
atgatgcaagtctacggaaaccagagaggtccttatggatcaatcaagaattttatgggttctgtcaagaatcaaggtccatgtaagccacgctatatgccttttccggctaatcaccggaaccaggtgccgccggtcggtcattttcagccccaatttcttccacctcgaccaaatttctacccatctccacaaaccctggtgccaccttattcatgtggtgggtacaattttcaaggttctggtccagtagtctctggtttgcttgggtctctaatggcacaaggtgtgatctcattgaaaaatcaaagcagaggaggactggagggggcattgcctgttcaaaatgctgctgctgatggtcctgtagtagttcctggtttgattgattctctcctggcacaagaggtcattttgttgaagaaacaaagcccggcactgaaggaggagaaggatgctatggtaggatgtgcgtttttcggcattgatctaaatctgcgtcgcaaatctgtggtaatcggcttgtatgagggtggcctgccaaggcaatgtaaaagctgtggcctccggttcaagtgtgaagaacagcataaaagccatatggattggctgcttgcttctgtttctcattgtaattga

Protein Analysis

212

Amino Acids

23.02

Weight (kDa)

9.32

Isoelectric Point (pI)

50.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 127, 202
AccI GTMKAC 1 cut(s) 12
AciI CCGC 1 cut(s) 131
AclWI GGATC 1 cut(s) 46
AcsI RAATTY 2 cut(s) 49, 175
AcuI CTGAAG 1 cut(s) 461
AdeI CACNNNGTG 1 cut(s) 287
AfaI GTAC 1 cut(s) 227
AfiI CCNNNNNNNGG 2 cut(s) 124, 137
AgsI TTSAA 5 cut(s) 236, 301, 344, 421, 574
AjnI CCWGG 4 cut(s) 123, 198, 376, 396
AluBI AGCT 1 cut(s) 558
AluI AGCT 1 cut(s) 558
Alw26I GTCTC 2 cut(s) 259, 276
AlwI GGATC 1 cut(s) 46
AoxI GGCC 2 cut(s) 535, 562
ApeKI GCWGC 3 cut(s) 350, 353, 610
ApoI RAATTY 2 cut(s) 49, 175
AspS9I GGNCC 4 cut(s) 29, 77, 245, 362
AsuC2I CCSGG 1 cut(s) 434
AsuHPI GGTGA 1 cut(s) 107
AvaII GGWCC 4 cut(s) 29, 77, 245, 362
BanI GGYRCC 2 cut(s) 127, 202
BbvI GCAGC 3 cut(s) 337, 340, 597
BccI CCATC 2 cut(s) 193, 353
BciT130I CCWGG 4 cut(s) 125, 200, 378, 398
BcnI CCSGG 1 cut(s) 434
BcoDI GTCTC 2 cut(s) 259, 276
BfmI CTRYAG 1 cut(s) 366
BisI GCNGC 4 cut(s) 131, 351, 354, 611
BlsI GCNGC 4 cut(s) 132, 352, 355, 612
Bme1390I CCNGG 5 cut(s) 125, 200, 378, 398, 434
Bme18I GGWCC 4 cut(s) 29, 77, 245, 362
BmgT120I GGNCC 4 cut(s) 29, 77, 245, 362
BmiI GGNNCC 3 cut(s) 122, 129, 204
BmrFI CCNGG 5 cut(s) 125, 200, 378, 398, 434
BmsI GCATC 1 cut(s) 445
BpmI CTGGAG 1 cut(s) 344
BpuMI CCSGG 1 cut(s) 434
BsaBI GATNNNNATC 1 cut(s) 492
BsaI GGTCTC 1 cut(s) 276
BsaJI CCNNGG 2 cut(s) 198, 542
BsaWI WCCGGW 2 cut(s) 117, 567
Bsc4I CCNNNNNNNGG 2 cut(s) 124, 137
Bse118I RCCGGY 1 cut(s) 133
Bse1I ACTGG 2 cut(s) 248, 327
Bse3DI GCAATG 2 cut(s) 332, 554
Bse8I GATNNNNATC 1 cut(s) 492
BseBI CCWGG 4 cut(s) 125, 200, 378, 398
BseDI CCNNGG 2 cut(s) 198, 542
BseGI GGATG 2 cut(s) 460, 473
BseJI GATNNNNATC 1 cut(s) 492
BseLI CCNNNNNNNGG 2 cut(s) 124, 137
BseMI GCAATG 2 cut(s) 332, 554
BseNI ACTGG 2 cut(s) 248, 327
BseRI GAGGAG 2 cut(s) 330, 461
BseXI GCAGC 3 cut(s) 337, 340, 597
Bsh1285I CGRYCG 1 cut(s) 138
BshFI GGCC 2 cut(s) 537, 564
BshNI GGYRCC 2 cut(s) 127, 202
BsiEI CGRYCG 1 cut(s) 138
BsiSI CCGG 5 cut(s) 107, 118, 134, 434, 568
BslI CCNNNNNNNGG 2 cut(s) 124, 137
BsmAI GTCTC 2 cut(s) 259, 276
BsnI GGCC 2 cut(s) 537, 564
Bso31I GGTCTC 1 cut(s) 276
Bsp143I GATC 3 cut(s) 38, 291, 487
BspACI CCGC 1 cut(s) 131
BspANI GGCC 2 cut(s) 537, 564
BspLI GGNNCC 3 cut(s) 122, 129, 204
BspPI GGATC 1 cut(s) 46
BspT107I GGYRCC 2 cut(s) 127, 202
BspTNI GGTCTC 1 cut(s) 276
BsrDI GCAATG 2 cut(s) 332, 554
BsrFI RCCGGY 1 cut(s) 133
BsrI ACTGG 2 cut(s) 248, 327
BssAI RCCGGY 1 cut(s) 133
BssECI CCNNGG 2 cut(s) 198, 542
BssMI GATC 3 cut(s) 38, 291, 487
BssT1I CCWWGG 1 cut(s) 542
Bst2UI CCWGG 4 cut(s) 125, 200, 378, 398
BstC8I GCNNGC 2 cut(s) 539, 615
BstF5I GGATG 2 cut(s) 460, 473
BstKTI GATC 3 cut(s) 41, 294, 490
BstMAI GTCTC 2 cut(s) 259, 276
BstMBI GATC 3 cut(s) 38, 291, 487
BstMCI CGRYCG 1 cut(s) 138
BstNI CCWGG 4 cut(s) 125, 200, 378, 398
BstSCI CCNGG 5 cut(s) 123, 198, 376, 396, 432
BstSFI CTRYAG 1 cut(s) 366
BstV1I GCAGC 3 cut(s) 337, 340, 597
BsuRI GGCC 2 cut(s) 537, 564
BtsCI GGATG 2 cut(s) 460, 473
BtsIMutI CAGTG 1 cut(s) 437
Cac8I GCNNGC 2 cut(s) 539, 615
Cfr10I RCCGGY 1 cut(s) 133
Cfr13I GGNCC 4 cut(s) 29, 77, 245, 362
CseI GACGC 1 cut(s) 488
CsiI ACCWGGT 1 cut(s) 123
Csp6I GTAC 1 cut(s) 226
CviAII CATG 2 cut(s) 81, 216
CviQI GTAC 1 cut(s) 226
DpnI GATC 3 cut(s) 40, 293, 489
DpnII GATC 3 cut(s) 38, 291, 487
DraIII CACNNNGTG 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 542
Eco31I GGTCTC 1 cut(s) 276
Eco47I GGWCC 4 cut(s) 29, 77, 245, 362
Eco57I CTGAAG 1 cut(s) 461
EcoO109I RGGNCCY 1 cut(s) 29
EcoRII CCWGG 4 cut(s) 123, 198, 376, 396
EcoT14I CCWWGG 1 cut(s) 542
ErhI CCWWGG 1 cut(s) 542
FaeI CATG 2 cut(s) 84, 219
FatI CATG 2 cut(s) 80, 215
FauNDI CATATG 1 cut(s) 600
FblI GTMKAC 1 cut(s) 12
Fnu4HI GCNGC 4 cut(s) 131, 351, 354, 611
FokI GGATG 2 cut(s) 467, 480
Fsp4HI GCNGC 4 cut(s) 131, 351, 354, 611
GluI GCNGC 4 cut(s) 131, 351, 354, 611
GsuI CTGGAG 1 cut(s) 344
HaeIII GGCC 2 cut(s) 537, 564
HapII CCGG 5 cut(s) 107, 118, 134, 434, 568
HgaI GACGC 1 cut(s) 488
Hin1II CATG 2 cut(s) 84, 219
HinfI GANTC 2 cut(s) 70, 389
HpaII CCGG 5 cut(s) 107, 118, 134, 434, 568
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 13
Hpy188III TCNNGA 2 cut(s) 46, 67
Hpy8I GTNNAC 1 cut(s) 13
Hpy99I CGWCG 1 cut(s) 504
HpyAV CCTTC 2 cut(s) 436, 445
HpyCH4V TGCA 1 cut(s) 7
Hsp92II CATG 2 cut(s) 84, 219
Kzo9I GATC 3 cut(s) 38, 291, 487
Lsp1109I GCAGC 3 cut(s) 337, 340, 597
LweI GCATC 1 cut(s) 445
MabI ACCWGGT 1 cut(s) 123
MalI GATC 3 cut(s) 40, 293, 489
MboI GATC 3 cut(s) 38, 291, 487
MboII GAAGA 3 cut(s) 152, 433, 593
MluCI AATT 5 cut(s) 49, 155, 175, 229, 634
MnlI CCTC 9 cut(s) 20, 177, 308, 311, 319, 400, 439, 523, 575
MspI CCGG 5 cut(s) 107, 118, 134, 434, 568
MspR9I CCNGG 5 cut(s) 125, 200, 378, 398, 434
MvaI CCWGG 4 cut(s) 125, 200, 378, 398
NciI CCSGG 1 cut(s) 434
NdeI CATATG 1 cut(s) 600
NdeII GATC 3 cut(s) 38, 291, 487
NlaIII CATG 2 cut(s) 84, 219
NlaIV GGNNCC 3 cut(s) 122, 129, 204
PfeI GAWTC 2 cut(s) 70, 389
PkrI GCNGC 4 cut(s) 132, 352, 355, 612
PpuMI RGGWCCY 1 cut(s) 29
Psp5II RGGWCCY 1 cut(s) 29
Psp6I CCWGG 4 cut(s) 123, 198, 376, 396
PspGI CCWGG 4 cut(s) 123, 198, 376, 396
PspN4I GGNNCC 3 cut(s) 122, 129, 204
PspPI GGNCC 4 cut(s) 29, 77, 245, 362
PspPPI RGGWCCY 1 cut(s) 29
RsaI GTAC 1 cut(s) 227
RsaNI GTAC 1 cut(s) 226
SatI GCNGC 4 cut(s) 131, 351, 354, 611
Sau3AI GATC 3 cut(s) 38, 291, 487
Sau96I GGNCC 4 cut(s) 29, 77, 245, 362
ScrFI CCNGG 5 cut(s) 125, 200, 378, 398, 434
SetI ASST 9 cut(s) 31, 79, 129, 169, 211, 241, 289, 411, 560
SexAI ACCWGGT 1 cut(s) 123
SfaNI GCATC 1 cut(s) 445
SfcI CTRYAG 1 cut(s) 366
SinI GGWCC 4 cut(s) 29, 77, 245, 362
Sse9I AATT 5 cut(s) 49, 155, 175, 229, 634
SsiI CCGC 1 cut(s) 131
StyD4I CCNGG 5 cut(s) 123, 198, 376, 396, 432
StyI CCWWGG 1 cut(s) 542
TaqI TCGA 1 cut(s) 169
TaqII GACCGA 1 cut(s) 128
TasI AATT 5 cut(s) 49, 155, 175, 229, 634
TauI GCSGC 1 cut(s) 133
TfiI GAWTC 2 cut(s) 70, 389
TscAI CASTG 1 cut(s) 444
TseI GCWGC 3 cut(s) 350, 353, 610
TspDTI ATGAA 1 cut(s) 204
TspGWI ACGGA 1 cut(s) 30
TspRI CASTG 1 cut(s) 444
VpaK11BI GGWCC 4 cut(s) 29, 77, 245, 362
XapI RAATTY 2 cut(s) 49, 175
XmiI GTMKAC 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.