Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000500.1

Orthogroup ID

OG0002193

Physical Location & Seq

Genomic Coordinates Reverse (-)

30745 .. 31631

Gene Structure 887 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000500.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

atgcatgagcttctagaagctgatttgcctgtgtcttccaagtttgatctggagatgcttaagaatggattagacttcatcggtatcaatcactataccagtttttatgcaaaagactgtctgttttctccatgtgaaccaggaccaggagctgcaaggatagaggggtatactttgagaactgaacaaaaagatggagtctacattggagaaccaactacaattgattggctatatgtgtatcctcaaggaatggagaagatggtaacatacataaaagaaagatacaacaaaccaatgtttattacagaaaatgggtatggtaagaattccacaaatgaagaactgttccatgatgtcaagagagtggagtacctgggtagttacttacaggcactagcagatgcaatgagacctaaaggagcagatgtaagagggtacttcgtgtggtcattgcttgatgatttcaagtggacaagtggatttatggtcaagtttggacttcaccatgttgattatggcactctcaagagaactccaagactctctgcagcttggtacagacaatttatcactaatcacaccctgcagattttaagcgcccaggaatattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0008150 GO:0008152 GO:0008422 GO:0015926 GO:0016787 GO:0016798 GO:0071704 GO:1901135 GO:1901657

KEGG Pathways

Metabolic & Signaling

ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110

Pfam Domains

Protein Families

Glyco_hydro_1

Protein Analysis

204

Amino Acids

23.63

Weight (kDa)

5.87

Isoelectric Point (pI)

28.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002193)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G21760 AT4G21760
fragaria_vesca	FvH4_3g02481 FvH4_3g02481 FvH4_3g02481 FvH4_3g02481 FvH4_3g02481
malus_domestica	MD05G1342500.v1.1 MD10G1316200.v1.1 MD10G1316300.v1.1 MD10G1316400.v1.1
prunus_persica	Prupe.4G024300_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1 Prupe.4G024400_v2.0.a1
pyrus_communis	pycom05g31180
rosa_chinensis	RchiOBHm_Chr5g0003741 RchiOBHm_Chr5g0003771 RchiOBHm_Chr5g0003781 RchiOBHm_Chr5g0003791
rosa_laevigata	RLG00000031172 RLG00000031174 RLG00000031175
rosa_multiflora	Rmu_sc0000500.1_g000007 Rmu_sc0013996.1_g000001
rosa_roxburghii	Rroxscaffold_1G00072200 Rroxscaffold_1G00072210 Rroxscaffold_1G00072220
rosa_rugosa	Rorug04G0406600 Rorug04G0406700
rosa_samantha	Rh5AG033600 Rh5AG033800 Rh5AG033900 Rh5BG032000 Rh5BG032300 Rh5BG032400 Rh5CG036300
rosa_wichuraiana	Rw5G003110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	170, 201
AcsI	RAATTY	1 cut(s)	328
AfaI	GTAC	3 cut(s)	374, 440, 560
AfiI	CCNNNNNNNGG	1 cut(s)	146
AflII	CTTAAG	1 cut(s)	59
AgsI	TTSAA	1 cut(s)	469
AjnI	CCWGG	4 cut(s)	139, 145, 375, 603
AluBI	AGCT	4 cut(s)	10, 20, 152, 554
AluI	AGCT	4 cut(s)	10, 20, 152, 554
Alw26I	GTCTC	1 cut(s)	406
AlwNI	CAGNNNCTG	1 cut(s)	152
ApeKI	GCWGC	2 cut(s)	152, 551
ApoI	RAATTY	1 cut(s)	328
AspLEI	GCGC	1 cut(s)	602
AspS9I	GGNCC	1 cut(s)	143
AsuHPI	GGTGA	1 cut(s)	497
AvaII	GGWCC	1 cut(s)	143
BbsI	GAAGAC	1 cut(s)	27
BbvI	GCAGC	2 cut(s)	139, 563
BccI	CCATC	2 cut(s)	188, 256
BciT130I	CCWGG	4 cut(s)	141, 147, 377, 605
BciVI	GTATCC	1 cut(s)	252
BcoDI	GTCTC	1 cut(s)	406
BfaI	CTAG	2 cut(s)	14, 398
BfmI	CTRYAG	2 cut(s)	549, 587
BfoI	RGCGCY	1 cut(s)	603
BfrI	CTTAAG	1 cut(s)	59
BfuI	GTATCC	1 cut(s)	252
BisI	GCNGC	2 cut(s)	153, 552
BlsI	GCNGC	2 cut(s)	154, 553
Bme1390I	CCNGG	4 cut(s)	141, 147, 377, 605
Bme18I	GGWCC	1 cut(s)	143
BmgT120I	GGNCC	1 cut(s)	143
BmrFI	CCNGG	4 cut(s)	141, 147, 377, 605
BmsI	GCATC	2 cut(s)	45, 394
BpiI	GAAGAC	1 cut(s)	27
BpmI	CTGGAG	1 cut(s)	71
BpuEI	CTTGAG	2 cut(s)	231, 512
BsaI	GGTCTC	1 cut(s)	406
BsaJI	CCNNGG	2 cut(s)	376, 603
BsaXI	ACNNNNNCTCC	2 cut(s)	414, 444
Bsc4I	CCNNNNNNNGG	1 cut(s)	146
Bse1I	ACTGG	1 cut(s)	99
Bse3DI	GCAATG	2 cut(s)	414, 452
BseBI	CCWGG	4 cut(s)	141, 147, 377, 605
BseDI	CCNNGG	2 cut(s)	376, 603
BseLI	CCNNNNNNNGG	1 cut(s)	146
BseMI	GCAATG	2 cut(s)	414, 452
BseNI	ACTGG	1 cut(s)	99
BseXI	GCAGC	2 cut(s)	139, 563
BslI	CCNNNNNNNGG	1 cut(s)	146
BsmAI	GTCTC	1 cut(s)	406
Bso31I	GGTCTC	1 cut(s)	406
Bsp143I	GATC	1 cut(s)	46
BspMAI	CTGCAG	2 cut(s)	553, 591
BspTI	CTTAAG	1 cut(s)	59
BspTNI	GGTCTC	1 cut(s)	406
BsrDI	GCAATG	2 cut(s)	414, 452
BsrI	ACTGG	1 cut(s)	99
BssECI	CCNNGG	2 cut(s)	376, 603
BssMI	GATC	1 cut(s)	46
BssNAI	GTATAC	1 cut(s)	171
Bst1107I	GTATAC	1 cut(s)	171
Bst2UI	CCWGG	4 cut(s)	141, 147, 377, 605
Bst4CI	ACNGT	2 cut(s)	119, 348
BstAFI	CTTAAG	1 cut(s)	59
BstH2I	RGCGCY	1 cut(s)	603
BstHHI	GCGC	1 cut(s)	602
BstKTI	GATC	1 cut(s)	49
BstMAI	GTCTC	1 cut(s)	406
BstMBI	GATC	1 cut(s)	46
BstNI	CCWGG	4 cut(s)	141, 147, 377, 605
BstSCI	CCNGG	4 cut(s)	139, 145, 375, 603
BstSFI	CTRYAG	2 cut(s)	549, 587
BstV1I	GCAGC	2 cut(s)	139, 563
BstV2I	GAAGAC	1 cut(s)	27
BstZ17I	GTATAC	1 cut(s)	171
BsuI	GTATCC	1 cut(s)	252
CaiI	CAGNNNCTG	1 cut(s)	152
CfoI	GCGC	1 cut(s)	602
Cfr13I	GGNCC	1 cut(s)	143
Csp6I	GTAC	3 cut(s)	373, 439, 559
CviAII	CATG	4 cut(s)	5, 132, 353, 509
CviJI	RGCY	5 cut(s)	10, 20, 152, 232, 554
CviKI_1	RGCY	5 cut(s)	10, 20, 152, 232, 554
CviQI	GTAC	3 cut(s)	373, 439, 559
DpnI	GATC	1 cut(s)	48
DpnII	GATC	1 cut(s)	46
Eco31I	GGTCTC	1 cut(s)	406
Eco47I	GGWCC	1 cut(s)	143
EcoRI	GAATTC	1 cut(s)	328
EcoRII	CCWGG	4 cut(s)	139, 145, 375, 603
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	4 cut(s)	8, 135, 356, 512
FatI	CATG	4 cut(s)	4, 131, 352, 508
FblI	GTMKAC	2 cut(s)	170, 201
Fnu4HI	GCNGC	2 cut(s)	153, 552
Fsp4HI	GCNGC	2 cut(s)	153, 552
FspBI	CTAG	2 cut(s)	14, 398
GlaI	GCGC	1 cut(s)	601
GluI	GCNGC	2 cut(s)	153, 552
GsuI	CTGGAG	1 cut(s)	71
HaeII	RGCGCY	1 cut(s)	603
HhaI	GCGC	1 cut(s)	602
Hin1II	CATG	4 cut(s)	8, 135, 356, 512
Hin6I	GCGC	1 cut(s)	600
HinP1I	GCGC	1 cut(s)	600
HinfI	GANTC	2 cut(s)	198, 543
HphI	GGTGA	1 cut(s)	497
Hpy166II	GTNNAC	4 cut(s)	137, 171, 202, 474
Hpy188III	TCNNGA	4 cut(s)	14, 50, 361, 529
Hpy8I	GTNNAC	4 cut(s)	137, 171, 202, 474
HpyCH4III	ACNGT	2 cut(s)	119, 348
HpyCH4V	TGCA	6 cut(s)	4, 110, 155, 407, 551, 589
Hsp92II	CATG	4 cut(s)	8, 135, 356, 512
HspAI	GCGC	1 cut(s)	600
Kzo9I	GATC	1 cut(s)	46
LmnI	GCTCC	2 cut(s)	149, 422
Lsp1109I	GCAGC	2 cut(s)	139, 563
LweI	GCATC	2 cut(s)	45, 394
MaeI	CTAG	2 cut(s)	14, 398
MaeIII	GTNAC	2 cut(s)	265, 383
MalI	GATC	1 cut(s)	48
MboI	GATC	1 cut(s)	46
MboII	GAAGA	3 cut(s)	27, 271, 353
MfeI	CAATTG	1 cut(s)	222
MluCI	AATT	3 cut(s)	222, 328, 566
MlyI	GAGTC	2 cut(s)	207, 537
MnlI	CCTC	3 cut(s)	157, 255, 428
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	2 cut(s)	60, 596
MspCI	CTTAAG	1 cut(s)	59
MspR9I	CCNGG	4 cut(s)	141, 147, 377, 605
MunI	CAATTG	1 cut(s)	222
MvaI	CCWGG	4 cut(s)	141, 147, 377, 605
NdeII	GATC	1 cut(s)	46
NlaIII	CATG	4 cut(s)	8, 135, 356, 512
NsiI	ATGCAT	1 cut(s)	6
PkrI	GCNGC	2 cut(s)	154, 553
PleI	GAGTC	2 cut(s)	206, 537
PpsI	GAGTC	2 cut(s)	206, 537
Psp6I	CCWGG	4 cut(s)	139, 145, 375, 603
PspGI	CCWGG	4 cut(s)	139, 145, 375, 603
PspPI	GGNCC	1 cut(s)	143
PstI	CTGCAG	2 cut(s)	553, 591
PstNI	CAGNNNCTG	1 cut(s)	152
RsaI	GTAC	3 cut(s)	374, 440, 560
RsaNI	GTAC	3 cut(s)	373, 439, 559
SaqAI	TTAA	2 cut(s)	60, 596
SatI	GCNGC	2 cut(s)	153, 552
Sau3AI	GATC	1 cut(s)	46
Sau96I	GGNCC	1 cut(s)	143
SchI	GAGTC	2 cut(s)	207, 537
ScrFI	CCNGG	4 cut(s)	141, 147, 377, 605
SetI	ASST	6 cut(s)	12, 22, 154, 378, 418, 556
SfaNI	GCATC	2 cut(s)	45, 394
SfcI	CTRYAG	2 cut(s)	549, 587
SinI	GGWCC	1 cut(s)	143
SmlI	CTYRAG	3 cut(s)	59, 246, 527
SmoI	CTYRAG	3 cut(s)	59, 246, 527
Sse9I	AATT	3 cut(s)	222, 328, 566
SspI	AATATT	1 cut(s)	611
SspMI	CTAG	2 cut(s)	14, 398
StyD4I	CCNGG	4 cut(s)	139, 145, 375, 603
TaaI	ACNGT	2 cut(s)	119, 348
TasI	AATT	3 cut(s)	222, 328, 566
Tru1I	TTAA	2 cut(s)	60, 596
Tru9I	TTAA	2 cut(s)	60, 596
TseI	GCWGC	2 cut(s)	152, 551
TspDTI	ATGAA	2 cut(s)	67, 354
Vha464I	CTTAAG	1 cut(s)	59
VpaK11BI	GGWCC	1 cut(s)	143
XapI	RAATTY	1 cut(s)	328
XbaI	TCTAGA	1 cut(s)	13
XcmI	CCANNNNNNNNNTGG	2 cut(s)	46, 515
XmiI	GTMKAC	2 cut(s)	170, 201
XspI	CTAG	2 cut(s)	14, 398
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.