Rmu_sc0000500.1_g000007

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000500.1
OG0002193
Physical Location & Seq
Reverse (-)
30745 .. 31631
887 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 615 bp
atgcatgagcttctagaagctgatttgcctgtgtcttccaagtttgatctggagatgcttaagaatggattagacttcatcggtatcaatcactataccagtttttatgcaaaagactgtctgttttctccatgtgaaccaggaccaggagctgcaaggatagaggggtatactttgagaactgaacaaaaagatggagtctacattggagaaccaactacaattgattggctatatgtgtatcctcaaggaatggagaagatggtaacatacataaaagaaagatacaacaaaccaatgtttattacagaaaatgggtatggtaagaattccacaaatgaagaactgttccatgatgtcaagagagtggagtacctgggtagttacttacaggcactagcagatgcaatgagacctaaaggagcagatgtaagagggtacttcgtgtggtcattgcttgatgatttcaagtggacaagtggatttatggtcaagtttggacttcaccatgttgattatggcactctcaagagaactccaagactctctgcagcttggtacagacaatttatcactaatcacaccctgcagattttaagcgcccaggaatattga

Protein Analysis

204

Amino Acids

23.63

Weight (kDa)

5.87

Isoelectric Point (pI)

28.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 9 - 194 7.1e-43 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 170, 201
AcsI RAATTY 1 cut(s) 328
AfaI GTAC 3 cut(s) 374, 440, 560
AfiI CCNNNNNNNGG 1 cut(s) 146
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 469
AjnI CCWGG 4 cut(s) 139, 145, 375, 603
AluBI AGCT 4 cut(s) 10, 20, 152, 554
AluI AGCT 4 cut(s) 10, 20, 152, 554
Alw26I GTCTC 1 cut(s) 406
AlwNI CAGNNNCTG 1 cut(s) 152
ApeKI GCWGC 2 cut(s) 152, 551
ApoI RAATTY 1 cut(s) 328
AspLEI GCGC 1 cut(s) 602
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 497
AvaII GGWCC 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 27
BbvI GCAGC 2 cut(s) 139, 563
BccI CCATC 2 cut(s) 188, 256
BciT130I CCWGG 4 cut(s) 141, 147, 377, 605
BciVI GTATCC 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 406
BfaI CTAG 2 cut(s) 14, 398
BfmI CTRYAG 2 cut(s) 549, 587
BfoI RGCGCY 1 cut(s) 603
BfrI CTTAAG 1 cut(s) 59
BfuI GTATCC 1 cut(s) 252
BisI GCNGC 2 cut(s) 153, 552
BlsI GCNGC 2 cut(s) 154, 553
Bme1390I CCNGG 4 cut(s) 141, 147, 377, 605
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmrFI CCNGG 4 cut(s) 141, 147, 377, 605
BmsI GCATC 2 cut(s) 45, 394
BpiI GAAGAC 1 cut(s) 27
BpmI CTGGAG 1 cut(s) 71
BpuEI CTTGAG 2 cut(s) 231, 512
BsaI GGTCTC 1 cut(s) 406
BsaJI CCNNGG 2 cut(s) 376, 603
BsaXI ACNNNNNCTCC 2 cut(s) 414, 444
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 99
Bse3DI GCAATG 2 cut(s) 414, 452
BseBI CCWGG 4 cut(s) 141, 147, 377, 605
BseDI CCNNGG 2 cut(s) 376, 603
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMI GCAATG 2 cut(s) 414, 452
BseNI ACTGG 1 cut(s) 99
BseXI GCAGC 2 cut(s) 139, 563
BslI CCNNNNNNNGG 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 406
Bso31I GGTCTC 1 cut(s) 406
Bsp143I GATC 1 cut(s) 46
BspMAI CTGCAG 2 cut(s) 553, 591
BspTI CTTAAG 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 406
BsrDI GCAATG 2 cut(s) 414, 452
BsrI ACTGG 1 cut(s) 99
BssECI CCNNGG 2 cut(s) 376, 603
BssMI GATC 1 cut(s) 46
BssNAI GTATAC 1 cut(s) 171
Bst1107I GTATAC 1 cut(s) 171
Bst2UI CCWGG 4 cut(s) 141, 147, 377, 605
Bst4CI ACNGT 2 cut(s) 119, 348
BstAFI CTTAAG 1 cut(s) 59
BstH2I RGCGCY 1 cut(s) 603
BstHHI GCGC 1 cut(s) 602
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 406
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 4 cut(s) 141, 147, 377, 605
BstSCI CCNGG 4 cut(s) 139, 145, 375, 603
BstSFI CTRYAG 2 cut(s) 549, 587
BstV1I GCAGC 2 cut(s) 139, 563
BstV2I GAAGAC 1 cut(s) 27
BstZ17I GTATAC 1 cut(s) 171
BsuI GTATCC 1 cut(s) 252
CaiI CAGNNNCTG 1 cut(s) 152
CfoI GCGC 1 cut(s) 602
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 3 cut(s) 373, 439, 559
CviAII CATG 4 cut(s) 5, 132, 353, 509
CviJI RGCY 5 cut(s) 10, 20, 152, 232, 554
CviKI_1 RGCY 5 cut(s) 10, 20, 152, 232, 554
CviQI GTAC 3 cut(s) 373, 439, 559
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco31I GGTCTC 1 cut(s) 406
Eco47I GGWCC 1 cut(s) 143
EcoRI GAATTC 1 cut(s) 328
EcoRII CCWGG 4 cut(s) 139, 145, 375, 603
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 8, 135, 356, 512
FatI CATG 4 cut(s) 4, 131, 352, 508
FblI GTMKAC 2 cut(s) 170, 201
Fnu4HI GCNGC 2 cut(s) 153, 552
Fsp4HI GCNGC 2 cut(s) 153, 552
FspBI CTAG 2 cut(s) 14, 398
GlaI GCGC 1 cut(s) 601
GluI GCNGC 2 cut(s) 153, 552
GsuI CTGGAG 1 cut(s) 71
HaeII RGCGCY 1 cut(s) 603
HhaI GCGC 1 cut(s) 602
Hin1II CATG 4 cut(s) 8, 135, 356, 512
Hin6I GCGC 1 cut(s) 600
HinP1I GCGC 1 cut(s) 600
HinfI GANTC 2 cut(s) 198, 543
HphI GGTGA 1 cut(s) 497
Hpy166II GTNNAC 4 cut(s) 137, 171, 202, 474
Hpy188III TCNNGA 4 cut(s) 14, 50, 361, 529
Hpy8I GTNNAC 4 cut(s) 137, 171, 202, 474
HpyCH4III ACNGT 2 cut(s) 119, 348
HpyCH4V TGCA 6 cut(s) 4, 110, 155, 407, 551, 589
Hsp92II CATG 4 cut(s) 8, 135, 356, 512
HspAI GCGC 1 cut(s) 600
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 2 cut(s) 149, 422
Lsp1109I GCAGC 2 cut(s) 139, 563
LweI GCATC 2 cut(s) 45, 394
MaeI CTAG 2 cut(s) 14, 398
MaeIII GTNAC 2 cut(s) 265, 383
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 3 cut(s) 27, 271, 353
MfeI CAATTG 1 cut(s) 222
MluCI AATT 3 cut(s) 222, 328, 566
MlyI GAGTC 2 cut(s) 207, 537
MnlI CCTC 3 cut(s) 157, 255, 428
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 60, 596
MspCI CTTAAG 1 cut(s) 59
MspR9I CCNGG 4 cut(s) 141, 147, 377, 605
MunI CAATTG 1 cut(s) 222
MvaI CCWGG 4 cut(s) 141, 147, 377, 605
NdeII GATC 1 cut(s) 46
NlaIII CATG 4 cut(s) 8, 135, 356, 512
NsiI ATGCAT 1 cut(s) 6
PkrI GCNGC 2 cut(s) 154, 553
PleI GAGTC 2 cut(s) 206, 537
PpsI GAGTC 2 cut(s) 206, 537
Psp6I CCWGG 4 cut(s) 139, 145, 375, 603
PspGI CCWGG 4 cut(s) 139, 145, 375, 603
PspPI GGNCC 1 cut(s) 143
PstI CTGCAG 2 cut(s) 553, 591
PstNI CAGNNNCTG 1 cut(s) 152
RsaI GTAC 3 cut(s) 374, 440, 560
RsaNI GTAC 3 cut(s) 373, 439, 559
SaqAI TTAA 2 cut(s) 60, 596
SatI GCNGC 2 cut(s) 153, 552
Sau3AI GATC 1 cut(s) 46
Sau96I GGNCC 1 cut(s) 143
SchI GAGTC 2 cut(s) 207, 537
ScrFI CCNGG 4 cut(s) 141, 147, 377, 605
SetI ASST 6 cut(s) 12, 22, 154, 378, 418, 556
SfaNI GCATC 2 cut(s) 45, 394
SfcI CTRYAG 2 cut(s) 549, 587
SinI GGWCC 1 cut(s) 143
SmlI CTYRAG 3 cut(s) 59, 246, 527
SmoI CTYRAG 3 cut(s) 59, 246, 527
Sse9I AATT 3 cut(s) 222, 328, 566
SspI AATATT 1 cut(s) 611
SspMI CTAG 2 cut(s) 14, 398
StyD4I CCNGG 4 cut(s) 139, 145, 375, 603
TaaI ACNGT 2 cut(s) 119, 348
TasI AATT 3 cut(s) 222, 328, 566
Tru1I TTAA 2 cut(s) 60, 596
Tru9I TTAA 2 cut(s) 60, 596
TseI GCWGC 2 cut(s) 152, 551
TspDTI ATGAA 2 cut(s) 67, 354
Vha464I CTTAAG 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 1 cut(s) 328
XbaI TCTAGA 1 cut(s) 13
XcmI CCANNNNNNNNNTGG 2 cut(s) 46, 515
XmiI GTMKAC 2 cut(s) 170, 201
XspI CTAG 2 cut(s) 14, 398
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.