Rmu_sc0001038.1_g000027

WAT1-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001038.1
Physical Location & Seq
Forward (+)
111878 .. 113604
1727 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001038.1_g000027.1.cds

Sequence Viewer

Length: 1107 bp
atgaagatctacagaagattcaagccacaccttctcatggttttggcacagatcggctatgcatgtctctacttcattactgatgcatccttcaatcatgggatgaaccctcatgtctttgtaacctatcgacatataattggtggcttagtcatgtttccatttgcctattttcttgaaagaaaagcaaggccaaagttgactctagcattgtttatggagatatttgtgatttcccttcttggggttagcttaacccttaatatgtattttgcaagcctgaagtacacatcttcaagcttcgtcacatcaatagccaataccataccatccctgacttttctgattgcagtcatactcaggatggaggctgtagatgtaaggaatccgcgcggaatagctaaactcttgggaaccttaatatctctggctggggtcatcaccatgacttcgtacaaaggacctgcaatacaaagcttctcgggagcatcacaacacataagaagtaattttgttcacaaaagctggacaaagggttcaatccttgtgattgcaagttgtataacatggtccatatggttcataatgcaggggatcacattgaagaaatatcctgcacaactgtcactaaccacatggatcaattgtatcggtgcagcacaatctgctgtgttcacagttatcatacatcacaaacgggcagcatggagaattacatacaacaatgatttctggtccatcatatatgctggagttgtatgctcaggtataacaatcttcattcaactatggtgtacaaaacaaaaaggacctgtcttcgtgaccatgttcagtcctcttgcaacagcattagtggctattctagcttacttcattctcggcgaaaagctgcacattggcagaatagtgggagcggtcattatcattatcggtctatacctagtcttatggggaaaagatagagatcaaaatcatttcaaatcccaagagcaacctaccgtgattagtgataaccagaaggaacccaagatgcaagtgggatcttcagcagaaagacaggtagtcctccaaatggaccttgaggaaaaagataaaaccgatggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

368

Amino Acids

41.3

Weight (kDa)

9.72

Isoelectric Point (pI)

32.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 472
AccBSI CCGCTC 1 cut(s) 914
AccII CGCG 2 cut(s) 391, 393
AciI CCGC 3 cut(s) 389, 393, 914
AclWI GGATC 3 cut(s) 602, 647, 1048
AcuI CTGAAG 2 cut(s) 302, 1029
AfaI GTAC 3 cut(s) 287, 455, 796
AfiI CCNNNNNNNGG 4 cut(s) 37, 243, 244, 1072
AgsI TTSAA 8 cut(s) 22, 94, 179, 297, 540, 604, 785, 979
AhdI GACNNNNNGTC 1 cut(s) 1061
AloI GAACNNNNNNTCC 2 cut(s) 520, 552
AluBI AGCT 7 cut(s) 252, 300, 401, 477, 525, 866, 889
AluI AGCT 7 cut(s) 252, 300, 401, 477, 525, 866, 889
Alw26I GTCTC 1 cut(s) 71
AlwI GGATC 3 cut(s) 602, 647, 1048
Ama87I CYCGRG 1 cut(s) 481
AoxI GGCC 1 cut(s) 191
ApeKI GCWGC 3 cut(s) 656, 701, 889
AspLEI GCGC 1 cut(s) 393
AspS9I GGNCC 5 cut(s) 461, 570, 735, 809, 1075
AsuHPI GGTGA 1 cut(s) 433
AvaI CYCGRG 1 cut(s) 481
AvaII GGWCC 5 cut(s) 461, 570, 735, 809, 1075
BbsI GAAGAC 1 cut(s) 808
BbvI GCAGC 3 cut(s) 668, 713, 876
BccI CCATC 4 cut(s) 337, 358, 746, 1094
BcoDI GTCTC 1 cut(s) 71
BfaI CTAG 3 cut(s) 206, 863, 941
BfmI CTRYAG 2 cut(s) 10, 372
BfuAI ACCTGC 1 cut(s) 472
BglII AGATCT 1 cut(s) 6
BisI GCNGC 3 cut(s) 657, 702, 890
BlsI GCNGC 3 cut(s) 658, 703, 891
Bme18I GGWCC 5 cut(s) 461, 570, 735, 809, 1075
BmeRI GACNNNNNGTC 1 cut(s) 1061
BmeT110I CYCGRG 1 cut(s) 481
BmgT120I GGNCC 5 cut(s) 461, 570, 735, 809, 1075
BmiI GGNNCC 2 cut(s) 415, 1023
BmsI GCATC 4 cut(s) 73, 95, 497, 1020
BpiI GAAGAC 1 cut(s) 808
BpmI CTGGAG 1 cut(s) 771
Bpu10I CCTNAGC 1 cut(s) 763
BpuEI CTTGAG 1 cut(s) 1100
BsaBI GATNNNNATC 2 cut(s) 963, 969
Bsc4I CCNNNNNNNGG 4 cut(s) 37, 243, 244, 1072
Bse8I GATNNNNATC 2 cut(s) 963, 969
BseGI GGATG 4 cut(s) 86, 108, 329, 369
BseJI GATNNNNATC 2 cut(s) 963, 969
BseLI CCNNNNNNNGG 4 cut(s) 37, 243, 244, 1072
BseMII CTCAG 2 cut(s) 373, 777
BseXI GCAGC 3 cut(s) 668, 713, 876
BseYI CCCAGC 1 cut(s) 431
BsgI GTGCAG 3 cut(s) 600, 675, 875
Bsh1236I CGCG 2 cut(s) 391, 393
BshFI GGCC 1 cut(s) 193
BsiHKCI CYCGRG 1 cut(s) 481
BslI CCNNNNNNNGG 4 cut(s) 37, 243, 244, 1072
BsmAI GTCTC 1 cut(s) 71
BsnI GGCC 1 cut(s) 193
BsoBI CYCGRG 1 cut(s) 481
Bsp1407I TGTACA 1 cut(s) 794
Bsp143I GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
BspACI CCGC 3 cut(s) 389, 393, 914
BspANI GGCC 1 cut(s) 193
BspCNI CTCAG 2 cut(s) 372, 776
BspFNI CGCG 2 cut(s) 391, 393
BspLI GGNNCC 2 cut(s) 415, 1023
BspMI ACCTGC 1 cut(s) 472
BspPI GGATC 3 cut(s) 602, 647, 1048
BsrBI CCGCTC 1 cut(s) 914
BsrGI TGTACA 1 cut(s) 794
BssMI GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
Bst4CI ACNGT 3 cut(s) 624, 679, 1000
BstAPI GCANNNNNTGC 1 cut(s) 665
BstAUI TGTACA 1 cut(s) 794
BstC8I GCNNGC 1 cut(s) 277
BstDEI CTNAG 3 cut(s) 148, 359, 763
BstF5I GGATG 4 cut(s) 86, 108, 329, 369
BstFNI CGCG 2 cut(s) 391, 393
BstHHI GCGC 1 cut(s) 393
BstKTI GATC 6 cut(s) 9, 54, 597, 642, 967, 1043
BstMAI GTCTC 1 cut(s) 71
BstMBI GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
BstMWI GCNNNNNNNGC 3 cut(s) 665, 854, 863
BstNSI RCATGY 1 cut(s) 66
BstSFI CTRYAG 2 cut(s) 10, 372
BstUI CGCG 2 cut(s) 391, 393
BstV1I GCAGC 3 cut(s) 668, 713, 876
BstV2I GAAGAC 1 cut(s) 808
BstX2I RGATCY 2 cut(s) 6, 1040
BstYI RGATCY 2 cut(s) 6, 1040
BsuRI GGCC 1 cut(s) 193
BtsCI GGATG 4 cut(s) 86, 108, 329, 369
BveI ACCTGC 1 cut(s) 472
Cac8I GCNNGC 1 cut(s) 277
CfoI GCGC 1 cut(s) 393
Cfr13I GGNCC 5 cut(s) 461, 570, 735, 809, 1075
Csp6I GTAC 3 cut(s) 286, 454, 795
CviQI GTAC 3 cut(s) 286, 454, 795
DdeI CTNAG 3 cut(s) 148, 359, 763
DpnI GATC 6 cut(s) 8, 53, 596, 641, 966, 1042
DpnII GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
DriI GACNNNNNGTC 1 cut(s) 1061
Eam1105I GACNNNNNGTC 1 cut(s) 1061
Eco47I GGWCC 5 cut(s) 461, 570, 735, 809, 1075
Eco57I CTGAAG 2 cut(s) 302, 1029
Eco88I CYCGRG 1 cut(s) 481
EcoO109I RGGNCCY 2 cut(s) 461, 809
EcoT22I ATGCAT 2 cut(s) 64, 88
FauNDI CATATG 1 cut(s) 575
Fnu4HI GCNGC 3 cut(s) 657, 702, 890
FokI GGATG 4 cut(s) 73, 115, 316, 376
Fsp4HI GCNGC 3 cut(s) 657, 702, 890
FspBI CTAG 3 cut(s) 206, 863, 941
GlaI GCGC 1 cut(s) 392
GluI GCNGC 3 cut(s) 657, 702, 890
GsaI CCCAGC 1 cut(s) 435
GsuI CTGGAG 1 cut(s) 771
HaeIII GGCC 1 cut(s) 193
HhaI GCGC 1 cut(s) 393
Hin6I GCGC 1 cut(s) 391
HinP1I GCGC 1 cut(s) 391
HincII GTYRAC 1 cut(s) 201
HindII GTYRAC 1 cut(s) 201
HindIII AAGCTT 2 cut(s) 298, 475
HinfI GANTC 3 cut(s) 18, 202, 385
HphI GGTGA 1 cut(s) 433
Hpy166II GTNNAC 5 cut(s) 201, 288, 517, 675, 795
Hpy188I TCNGA 1 cut(s) 345
Hpy188III TCNNGA 4 cut(s) 176, 361, 483, 820
Hpy8I GTNNAC 5 cut(s) 201, 288, 517, 675, 795
HpyAV CCTTC 4 cut(s) 41, 100, 248, 1012
HpyCH4III ACNGT 3 cut(s) 624, 679, 1000
HpyF10VI GCNNNNNNNGC 3 cut(s) 665, 854, 863
HpyF3I CTNAG 3 cut(s) 148, 359, 763
HspAI GCGC 1 cut(s) 391
Kzo9I GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
LmnI GCTCC 2 cut(s) 485, 911
Lsp1109I GCAGC 3 cut(s) 668, 713, 876
LweI GCATC 4 cut(s) 73, 95, 497, 1020
MaeI CTAG 3 cut(s) 206, 863, 941
MaeIII GTNAC 4 cut(s) 121, 304, 624, 820
MalI GATC 6 cut(s) 8, 53, 596, 641, 966, 1042
MbiI CCGCTC 1 cut(s) 914
MboI GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
MboII GAAGA 7 cut(s) 16, 27, 285, 616, 769, 808, 1035
MfeI CAATTG 1 cut(s) 643
MflI RGATCY 2 cut(s) 6, 1040
MluCI AATT 4 cut(s) 138, 508, 643, 711
MlyI GAGTC 1 cut(s) 196
MnlI CCTC 5 cut(s) 120, 361, 846, 1075, 1076
Mph1103I ATGCAT 2 cut(s) 64, 88
MseI TTAA 3 cut(s) 254, 261, 419
MslI CAYNNNNRTG 1 cut(s) 443
MunI CAATTG 1 cut(s) 643
MvnI CGCG 2 cut(s) 391, 393
MwoI GCNNNNNNNGC 3 cut(s) 665, 854, 863
NdeI CATATG 1 cut(s) 575
NdeII GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
NlaIV GGNNCC 2 cut(s) 415, 1023
NmeAIII GCCGAG 1 cut(s) 858
NmuCI GTSAC 3 cut(s) 304, 624, 820
NsiI ATGCAT 2 cut(s) 64, 88
NspI RCATGY 1 cut(s) 66
PfeI GAWTC 2 cut(s) 18, 385
PkrI GCNGC 3 cut(s) 658, 703, 891
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
PpuMI RGGWCCY 2 cut(s) 461, 809
Psp5II RGGWCCY 2 cut(s) 461, 809
PspFI CCCAGC 1 cut(s) 431
PspN4I GGNNCC 2 cut(s) 415, 1023
PspPI GGNCC 5 cut(s) 461, 570, 735, 809, 1075
PspPPI RGGWCCY 2 cut(s) 461, 809
PsuI RGATCY 2 cut(s) 6, 1040
RsaI GTAC 3 cut(s) 287, 455, 796
RsaNI GTAC 3 cut(s) 286, 454, 795
RseI CAYNNNNRTG 1 cut(s) 443
SaqAI TTAA 3 cut(s) 254, 261, 419
SatI GCNGC 3 cut(s) 657, 702, 890
Sau3AI GATC 6 cut(s) 6, 51, 594, 639, 964, 1040
Sau96I GGNCC 5 cut(s) 461, 570, 735, 809, 1075
SchI GAGTC 1 cut(s) 196
SfaNI GCATC 4 cut(s) 73, 95, 497, 1020
SfcI CTRYAG 2 cut(s) 10, 372
SinI GGWCC 5 cut(s) 461, 570, 735, 809, 1075
SmiMI CAYNNNNRTG 1 cut(s) 443
SmlI CTYRAG 1 cut(s) 1079
SmoI CTYRAG 1 cut(s) 1079
Sse9I AATT 4 cut(s) 138, 508, 643, 711
SsiI CCGC 3 cut(s) 389, 393, 914
SspMI CTAG 3 cut(s) 206, 863, 941
TaaI ACNGT 3 cut(s) 624, 679, 1000
TaqI TCGA 1 cut(s) 130
TaqII GACCGA 1 cut(s) 920
TasI AATT 4 cut(s) 138, 508, 643, 711
TatI WGTACW 2 cut(s) 285, 794
TfiI GAWTC 2 cut(s) 18, 385
Tru1I TTAA 3 cut(s) 254, 261, 419
Tru9I TTAA 3 cut(s) 254, 261, 419
TseFI GTSAC 3 cut(s) 304, 624, 820
TseI GCWGC 3 cut(s) 656, 701, 889
Tsp45I GTSAC 3 cut(s) 304, 624, 820
TspDTI ATGAA 6 cut(s) 17, 64, 119, 571, 769, 862
VpaK11BI GGWCC 5 cut(s) 461, 570, 735, 809, 1075
XceI RCATGY 1 cut(s) 66
XcmI CCANNNNNNNNNTGG 1 cut(s) 1033
XspI CTAG 3 cut(s) 206, 863, 941
Zsp2I ATGCAT 2 cut(s) 64, 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.