Rorug06G0196400

WAT1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0002399
Physical Location & Seq
Reverse (-)
31677392 .. 31679477
2086 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0196400.1

Sequence Viewer

Length: 579 bp
ATGGCTTTGTCACCATATGTGGAAAGTGGAAAGTGGAAACCTAGACTTTTTCGCACCAGCAACCGTGGTTCTGTAGCTATTTGGAACCTAAGCAGTACCACTGCTTATGAACAGTGTGGTGACGCTTTTGTCCCTGGCTGTTGGGAGTTTACTCAATTGCCACTGAAGTATAATTCAGCATTTCAGCTCCACCTCCACCTCCACCTCCACCTCCACCACTACTATCCAAGTCAGCAGCGGCAGGAACTTGATCAAAGCTTACTACATTCCACATCCTTAGTTGCTTGCATTCTGGTTTGGTTTGATAGAGTAGTAAAGCCTCTCTCAACATGGATTAGGCTTCACTCAGCTGGGCATTTGCTAGATGTATGTATGAAGAATGTGGGATTAGGTGATTTAAAGCCACGCAAAGGCTACCATTTCCCTCAAGGACAGGTAAGAGACCTGGAAAGGGAGGCAACCGATTGTGGGAGAGAATTGGGCTGGGCTAAAGACCCCAGGGATGCTATTGAAGGACCACACTTGCTGGAAAGATTTGCAGCATGTCCTTCTGATCTTGTACCAGTGAAAGTTCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EamA

Protein Analysis

192

Amino Acids

21.91

Weight (kDa)

8.23

Isoelectric Point (pI)

37.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 128
AciI CCGC 1 cut(s) 238
AcuI CTGAAG 1 cut(s) 185
AfaI GTAC 2 cut(s) 97, 561
AfiI CCNNNNNNNGG 3 cut(s) 410, 451, 468
AgsI TTSAA 1 cut(s) 512
AjnI CCWGG 3 cut(s) 133, 444, 497
AluBI AGCT 4 cut(s) 77, 187, 258, 350
AluI AGCT 4 cut(s) 77, 187, 258, 350
Alw26I GTCTC 1 cut(s) 435
ApeKI GCWGC 2 cut(s) 235, 539
AspS9I GGNCC 1 cut(s) 515
AsuHPI GGTGA 3 cut(s) 3, 131, 404
AvaII GGWCC 1 cut(s) 515
BbvI GCAGC 2 cut(s) 247, 551
BciT130I CCWGG 3 cut(s) 135, 446, 499
BclI TGATCA 1 cut(s) 250
BcoDI GTCTC 1 cut(s) 435
BfaI CTAG 2 cut(s) 42, 362
BfmI CTRYAG 2 cut(s) 72, 575
BisI GCNGC 3 cut(s) 236, 239, 540
BlsI GCNGC 3 cut(s) 237, 240, 541
Bme1390I CCNGG 3 cut(s) 135, 446, 499
Bme18I GGWCC 1 cut(s) 515
BmgT120I GGNCC 1 cut(s) 515
BmiI GGNNCC 1 cut(s) 86
BmrFI CCNGG 3 cut(s) 135, 446, 499
BmsI GCATC 1 cut(s) 493
Bpu10I CCTNAGC 1 cut(s) 89
BpuEI CTTGAG 1 cut(s) 411
BsaI GGTCTC 1 cut(s) 435
BsaJI CCNNGG 4 cut(s) 64, 133, 497, 498
Bsc4I CCNNNNNNNGG 3 cut(s) 410, 451, 468
Bse1I ACTGG 1 cut(s) 563
BseBI CCWGG 3 cut(s) 135, 446, 499
BseDI CCNNGG 4 cut(s) 64, 133, 497, 498
BseGI GGATG 2 cut(s) 272, 508
BseLI CCNNNNNNNGG 3 cut(s) 410, 451, 468
BseMII CTCAG 1 cut(s) 360
BseNI ACTGG 1 cut(s) 563
BseXI GCAGC 2 cut(s) 247, 551
BseYI CCCAGC 2 cut(s) 350, 483
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 3 cut(s) 410, 451, 468
BsmAI GTCTC 1 cut(s) 435
BsmFI GGGAC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 288
Bso31I GGTCTC 1 cut(s) 435
Bsp143I GATC 2 cut(s) 250, 553
BspACI CCGC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 359
BspLI GGNNCC 1 cut(s) 86
BspTNI GGTCTC 1 cut(s) 435
BsrI ACTGG 1 cut(s) 563
BssECI CCNNGG 4 cut(s) 64, 133, 497, 498
BssMI GATC 2 cut(s) 250, 553
Bst2UI CCWGG 3 cut(s) 135, 446, 499
Bst4CI ACNGT 2 cut(s) 65, 114
BstC8I GCNNGC 1 cut(s) 286
BstDEI CTNAG 3 cut(s) 89, 277, 346
BstDSI CCRYGG 1 cut(s) 64
BstF5I GGATG 2 cut(s) 272, 508
BstKTI GATC 2 cut(s) 253, 556
BstMAI GTCTC 1 cut(s) 435
BstMBI GATC 2 cut(s) 250, 553
BstNI CCWGG 3 cut(s) 135, 446, 499
BstNSI RCATGY 1 cut(s) 546
BstSCI CCNGG 3 cut(s) 133, 444, 497
BstSFI CTRYAG 2 cut(s) 72, 575
BstV1I GCAGC 2 cut(s) 247, 551
BtgI CCRYGG 1 cut(s) 64
BtsCI GGATG 2 cut(s) 272, 508
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 4 cut(s) 99, 119, 161, 570
Cac8I GCNNGC 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 515
CseI GACGC 1 cut(s) 131
Csp6I GTAC 2 cut(s) 96, 560
CviAII CATG 2 cut(s) 330, 543
CviQI GTAC 2 cut(s) 96, 560
DdeI CTNAG 3 cut(s) 89, 277, 346
DpnI GATC 2 cut(s) 252, 555
DpnII GATC 2 cut(s) 250, 553
DraI TTTAAA 1 cut(s) 399
DrdI GACNNNNNNGTC 1 cut(s) 128
DseDI GACNNNNNNGTC 1 cut(s) 128
Eco31I GGTCTC 1 cut(s) 435
Eco47I GGWCC 1 cut(s) 515
Eco57I CTGAAG 1 cut(s) 185
EcoRII CCWGG 3 cut(s) 133, 444, 497
FaeI CATG 2 cut(s) 333, 546
FaiI YATR 9 cut(s) 16, 18, 108, 171, 331, 370, 374, 544, 577
FaqI GGGAC 1 cut(s) 116
FatI CATG 2 cut(s) 329, 542
FauNDI CATATG 1 cut(s) 16
FbaI TGATCA 1 cut(s) 250
Fnu4HI GCNGC 3 cut(s) 236, 239, 540
FokI GGATG 2 cut(s) 259, 515
Fsp4HI GCNGC 3 cut(s) 236, 239, 540
FspBI CTAG 2 cut(s) 42, 362
GluI GCNGC 3 cut(s) 236, 239, 540
GsaI CCCAGC 2 cut(s) 354, 487
HgaI GACGC 1 cut(s) 131
Hin1II CATG 2 cut(s) 333, 546
HindIII AAGCTT 1 cut(s) 256
HphI GGTGA 3 cut(s) 3, 131, 404
Hpy166II GTNNAC 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 553
Hpy8I GTNNAC 1 cut(s) 150
HpyAV CCTTC 2 cut(s) 506, 558
HpyCH4III ACNGT 2 cut(s) 65, 114
HpyCH4V TGCA 2 cut(s) 288, 539
HpyF3I CTNAG 3 cut(s) 89, 277, 346
Hsp92II CATG 2 cut(s) 333, 546
Ksp22I TGATCA 1 cut(s) 250
Kzo9I GATC 2 cut(s) 250, 553
LmnI GCTCC 1 cut(s) 192
Lsp1109I GCAGC 2 cut(s) 247, 551
LweI GCATC 1 cut(s) 493
MaeI CTAG 2 cut(s) 42, 362
MaeIII GTNAC 2 cut(s) 9, 119
MalI GATC 2 cut(s) 252, 555
MboI GATC 2 cut(s) 250, 553
MboII GAAGA 1 cut(s) 388
MfeI CAATTG 1 cut(s) 155
MluCI AATT 3 cut(s) 155, 172, 476
MnlI CCTC 7 cut(s) 203, 209, 215, 221, 330, 435, 448
MseI TTAA 1 cut(s) 398
MspA1I CMGCKG 2 cut(s) 238, 350
MspR9I CCNGG 3 cut(s) 135, 446, 499
MunI CAATTG 1 cut(s) 155
Mva1269I GAATGC 1 cut(s) 288
MvaI CCWGG 3 cut(s) 135, 446, 499
NdeI CATATG 1 cut(s) 16
NdeII GATC 2 cut(s) 250, 553
NlaIII CATG 2 cut(s) 333, 546
NlaIV GGNNCC 1 cut(s) 86
NmuCI GTSAC 2 cut(s) 9, 119
NspI RCATGY 1 cut(s) 546
PasI CCCWGGG 1 cut(s) 498
PctI GAATGC 1 cut(s) 288
PkrI GCNGC 3 cut(s) 237, 240, 541
Psp6I CCWGG 3 cut(s) 133, 444, 497
PspFI CCCAGC 2 cut(s) 350, 483
PspGI CCWGG 3 cut(s) 133, 444, 497
PspN4I GGNNCC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 515
PvuII CAGCTG 1 cut(s) 350
RsaI GTAC 2 cut(s) 97, 561
RsaNI GTAC 2 cut(s) 96, 560
SaqAI TTAA 1 cut(s) 398
SatI GCNGC 3 cut(s) 236, 239, 540
Sau3AI GATC 2 cut(s) 250, 553
Sau96I GGNCC 1 cut(s) 515
ScrFI CCNGG 3 cut(s) 135, 446, 499
SfaNI GCATC 1 cut(s) 493
SfcI CTRYAG 2 cut(s) 72, 575
SinI GGWCC 1 cut(s) 515
SmlI CTYRAG 1 cut(s) 426
SmoI CTYRAG 1 cut(s) 426
Sse9I AATT 3 cut(s) 155, 172, 476
SsiI CCGC 1 cut(s) 238
SspMI CTAG 2 cut(s) 42, 362
StyD4I CCNGG 3 cut(s) 133, 444, 497
TaaI ACNGT 2 cut(s) 65, 114
TasI AATT 3 cut(s) 155, 172, 476
TauI GCSGC 1 cut(s) 241
Tru1I TTAA 1 cut(s) 398
Tru9I TTAA 1 cut(s) 398
TscAI CASTG 4 cut(s) 106, 119, 168, 570
TseFI GTSAC 2 cut(s) 9, 119
TseI GCWGC 2 cut(s) 235, 539
Tsp45I GTSAC 2 cut(s) 9, 119
TspDTI ATGAA 2 cut(s) 123, 389
TspRI CASTG 4 cut(s) 106, 119, 168, 570
VpaK11BI GGWCC 1 cut(s) 515
XceI RCATGY 1 cut(s) 546
XspI CTAG 2 cut(s) 42, 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.