Rmu_sc0001918.1_g000006

Pentatricopeptide repeat-containing protein At5g61990

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001918.1
Physical Location & Seq
Reverse (-)
18318 .. 18848
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001918.1_g000006.1.cds

Sequence Viewer

Length: 531 bp
atggctgttgttttgtgtaattccaagctttttgggcatgcccatggtgtgttggagagaatagttaggacccagaagccggctttagaagttttggattgtgttgttaggtgctttagagagtttgaggggtctgatatggtggtttttgagattttgattaatgtgtttacgatggggggttggttttatgaggctgctgatgtgtttttgggtgttaggagtgttgggatttcaccgagattggaatgctgtaattctctgttaaatgacttgttgaagggtaataggatgaggctgttctggaaaatgtatgatgggatgttagaggctaagattgagctagatttttacacttatagtaatgtgatcaatgcacaatattgtaagtttggggatgttaggcagggtaagaggctactgtttgagatggttgatggattgtgtagaagtagggctgttgatgaagccattgagttgaaaaaatcgatggttgagaagggattgacacctgataggtatacatattaa

Protein Analysis

176

Amino Acids

20.24

Weight (kDa)

6.73

Isoelectric Point (pI)

28.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 521
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 2 cut(s) 280, 481
AluBI AGCT 2 cut(s) 28, 343
AluI AGCT 2 cut(s) 28, 343
ApeKI GCWGC 1 cut(s) 197
AseI ATTAAT 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 228
AvaII GGWCC 1 cut(s) 69
BbvI GCAGC 1 cut(s) 184
BccI CCATC 5 cut(s) 169, 311, 424, 431, 484
BclI TGATCA 1 cut(s) 369
BfaI CTAG 1 cut(s) 344
BisI GCNGC 1 cut(s) 198
BlsI GCNGC 1 cut(s) 199
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 71
Bsa29I ATCGAT 1 cut(s) 488
BsaJI CCNNGG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse118I RCCGGY 1 cut(s) 79
BseCI ATCGAT 1 cut(s) 488
BseDI CCNNGG 1 cut(s) 43
BseGI GGATG 3 cut(s) 297, 327, 403
BseLI CCNNNNNNNGG 1 cut(s) 79
BseXI GCAGC 1 cut(s) 184
BshVI ATCGAT 1 cut(s) 488
BsiSI CCGG 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 79
BsmI GAATGC 1 cut(s) 254
Bsp143I GATC 1 cut(s) 369
Bsp19I CCATGG 1 cut(s) 43
BspDI ATCGAT 1 cut(s) 488
BspLI GGNNCC 1 cut(s) 71
BsrFI RCCGGY 1 cut(s) 79
BssAI RCCGGY 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 43
BssMI GATC 1 cut(s) 369
BssNAI GTATAC 1 cut(s) 522
BssT1I CCWWGG 1 cut(s) 43
Bst1107I GTATAC 1 cut(s) 522
Bst4CI ACNGT 1 cut(s) 423
BstC8I GCNNGC 2 cut(s) 39, 81
BstDEI CTNAG 1 cut(s) 333
BstDSI CCRYGG 1 cut(s) 43
BstF5I GGATG 3 cut(s) 297, 327, 403
BstKTI GATC 1 cut(s) 372
BstMBI GATC 1 cut(s) 369
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNSI RCATGY 1 cut(s) 41
BstV1I GCAGC 1 cut(s) 184
BstZ17I GTATAC 1 cut(s) 522
Bsu15I ATCGAT 1 cut(s) 488
BsuTUI ATCGAT 1 cut(s) 488
BtgI CCRYGG 1 cut(s) 43
BtsCI GGATG 3 cut(s) 297, 327, 403
Cac8I GCNNGC 2 cut(s) 39, 81
Cfr10I RCCGGY 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 69
ClaI ATCGAT 1 cut(s) 488
CviAII CATG 2 cut(s) 38, 44
DdeI CTNAG 1 cut(s) 333
DpnI GATC 1 cut(s) 371
DpnII GATC 1 cut(s) 369
Eco130I CCWWGG 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 43
ErhI CCWWGG 1 cut(s) 43
FaeI CATG 2 cut(s) 41, 47
FaiI YATR 8 cut(s) 39, 45, 140, 192, 315, 360, 522, 526
FatI CATG 2 cut(s) 37, 43
FbaI TGATCA 1 cut(s) 369
FblI GTMKAC 1 cut(s) 521
Fnu4HI GCNGC 1 cut(s) 198
FokI GGATG 3 cut(s) 304, 334, 410
Fsp4HI GCNGC 1 cut(s) 198
FspBI CTAG 1 cut(s) 344
GluI GCNGC 1 cut(s) 198
HapII CCGG 1 cut(s) 80
Hin1II CATG 2 cut(s) 41, 47
HindIII AAGCTT 1 cut(s) 26
HpaII CCGG 1 cut(s) 80
HphI GGTGA 1 cut(s) 228
Hpy166II GTNNAC 2 cut(s) 171, 522
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 304
Hpy8I GTNNAC 2 cut(s) 171, 522
HpyAV CCTTC 2 cut(s) 274, 493
HpyCH4III ACNGT 1 cut(s) 423
HpyCH4V TGCA 1 cut(s) 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 2 cut(s) 41, 47
KroI GCCGGC 1 cut(s) 79
KroNI GCCGGC 1 cut(s) 81
Ksp22I TGATCA 1 cut(s) 369
Kzo9I GATC 1 cut(s) 369
LpnPI CCDG 5 cut(s) 86, 93, 289, 392, 525
Lsp1109I GCAGC 1 cut(s) 184
MaeI CTAG 1 cut(s) 344
MalI GATC 1 cut(s) 371
MboI GATC 1 cut(s) 369
MluCI AATT 2 cut(s) 19, 256
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 5 cut(s) 121, 187, 288, 322, 408
MroNI GCCGGC 1 cut(s) 79
MseI TTAA 3 cut(s) 162, 266, 529
MslI CAYNNNNRTG 1 cut(s) 42
MspI CCGG 1 cut(s) 80
Mva1269I GAATGC 1 cut(s) 254
MwoI GCNNNNNNNGC 1 cut(s) 34
NaeI GCCGGC 1 cut(s) 81
NcoI CCATGG 1 cut(s) 43
NdeII GATC 1 cut(s) 369
NgoMIV GCCGGC 1 cut(s) 79
NlaIII CATG 2 cut(s) 41, 47
NlaIV GGNNCC 1 cut(s) 71
NspI RCATGY 1 cut(s) 41
PaeI GCATGC 1 cut(s) 41
PctI GAATGC 1 cut(s) 254
PdiI GCCGGC 1 cut(s) 81
PkrI GCNGC 1 cut(s) 199
PpuMI RGGWCCY 1 cut(s) 69
PshBI ATTAAT 1 cut(s) 162
Psp5II RGGWCCY 1 cut(s) 69
PspN4I GGNNCC 1 cut(s) 71
PspPI GGNCC 1 cut(s) 69
PspPPI RGGWCCY 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 3 cut(s) 162, 266, 529
SatI GCNGC 1 cut(s) 198
Sau3AI GATC 1 cut(s) 369
Sau96I GGNCC 1 cut(s) 69
SetI ASST 5 cut(s) 30, 113, 345, 514, 521
SinI GGWCC 1 cut(s) 69
SmiMI CAYNNNNRTG 1 cut(s) 42
SphI GCATGC 1 cut(s) 41
Sse9I AATT 2 cut(s) 19, 256
SspI AATATT 1 cut(s) 383
SspMI CTAG 1 cut(s) 344
StyI CCWWGG 1 cut(s) 43
TaaI ACNGT 1 cut(s) 423
TaqI TCGA 1 cut(s) 488
TasI AATT 2 cut(s) 19, 256
Tru1I TTAA 3 cut(s) 162, 266, 529
Tru9I TTAA 3 cut(s) 162, 266, 529
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 480
VpaK11BI GGWCC 1 cut(s) 69
VspI ATTAAT 1 cut(s) 162
XceI RCATGY 1 cut(s) 41
XmiI GTMKAC 1 cut(s) 521
XspI CTAG 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.