Rh2CG348200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
46987403 .. 46987945
543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG348200.1

Sequence Viewer

Length: 543 bp
ATGGTAGAGAAGGGCTGTAATCAGAATTTGAGTACCTTCAATGTGGTGATTGATGGATTGTGTAGAAGTAGGGCTGTTCATGAAGCCATTGAGTTGAAAAAATCGATGGTTGAGAAGGGATTGACACCTGATAGGTATACATATTCAATACTAATTGATGGATTGTGCAGACAGAAGAGATCAGAAGAAGCAAAGTTGGTATTGAACGAGATGTATGATATAAGTTTGAATCCTGACCGCACCTTGTACATTGCTTTGATTGATGGATTCTTGAAAGAAAATAACGTGGATAAGGCCCTCAGGATCAAAGAAGAGATGGTCGCTCGAGGAGTTAAGTTGTGCGGTGTCACATATAATGTGATTTGTGCAGGGATCTGTAAAATAGGTAAGATGGAGAAGGCAGAATCTCTTTTGAATGAGATGAATGCTATGGGAATTGAACCTAATACCCAGACATATAACTATTTAATTGATGGGTACTGTCGGGAGCAAAATGTAAACAAGGCTTATGCATTACTTAATGAGATGAAGCAAAGGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

180

Amino Acids

20.45

Weight (kDa)

7.5

Isoelectric Point (pI)

30.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 4 - 37 2.3e-07 PPR repeat
PPR_2 PF13041 9 - 57 1.4e-17 PPR repeat family
PPR PF01535 11 - 41 4.1e-06 PPR repeat
PPR_long PF17177 23 - 114 2e-06 Pentacotripeptide-repeat region of PRORP
PPR_1 PF12854 39 - 71 3e-11 PPR repeat
PPR PF01535 46 - 71 7.3e-06 PPR repeat
PPR_2 PF13041 78 - 121 1.4e-07 PPR repeat family
PPR_3 PF13812 101 - 160 4.6e-11 Pentatricopeptide repeat domain
PPR_2 PF13041 116 - 162 1.9e-16 PPR repeat family
PPR_3 PF13812 136 - 178 3.4e-06 Pentatricopeptide repeat domain
PPR_1 PF12854 144 - 177 3.6e-13 PPR repeat
PPR_2 PF13041 152 - 179 2.2e-08 PPR repeat family
PPR PF01535 152 - 179 3.9e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 137
AciI CCGC 2 cut(s) 238, 342
AclWI GGATC 2 cut(s) 311, 380
AcsI RAATTY 1 cut(s) 25
AfaI GTAC 3 cut(s) 34, 248, 479
AgsI TTSAA 8 cut(s) 40, 97, 147, 205, 229, 274, 415, 440
AlwI GGATC 2 cut(s) 311, 380
Ama87I CYCGRG 1 cut(s) 324
AoxI GGCC 1 cut(s) 294
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 295
AsuHPI GGTGA 1 cut(s) 58
AvaI CYCGRG 1 cut(s) 324
AxyI CCTNAGG 1 cut(s) 299
BccI CCATC 7 cut(s) 47, 100, 152, 257, 310, 385, 467
BmeT110I CYCGRG 1 cut(s) 324
BmgT120I GGNCC 1 cut(s) 295
Bsa29I ATCGAT 1 cut(s) 104
Bse21I CCTNAGG 1 cut(s) 299
Bse3DI GCAATG 1 cut(s) 249
BseCI ATCGAT 1 cut(s) 104
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 313
BseRI GAGGAG 1 cut(s) 342
BsgI GTGCAG 2 cut(s) 187, 387
BshFI GGCC 1 cut(s) 296
BshVI ATCGAT 1 cut(s) 104
BsiHKCI CYCGRG 1 cut(s) 324
BsmI GAATGC 1 cut(s) 430
BsnI GGCC 1 cut(s) 296
BsoBI CYCGRG 1 cut(s) 324
Bsp1407I TGTACA 1 cut(s) 246
Bsp143I GATC 3 cut(s) 179, 303, 372
BspACI CCGC 2 cut(s) 238, 342
BspANI GGCC 1 cut(s) 296
BspCNI CTCAG 1 cut(s) 312
BspDI ATCGAT 1 cut(s) 104
BspHI TCATGA 1 cut(s) 79
BspPI GGATC 2 cut(s) 311, 380
BsrDI GCAATG 1 cut(s) 249
BsrGI TGTACA 1 cut(s) 246
BssMI GATC 3 cut(s) 179, 303, 372
BssNAI GTATAC 1 cut(s) 138
Bst1107I GTATAC 1 cut(s) 138
Bst4CI ACNGT 1 cut(s) 482
Bst6I CTCTTC 2 cut(s) 170, 306
BstAUI TGTACA 1 cut(s) 246
BstDEI CTNAG 1 cut(s) 299
BstKTI GATC 3 cut(s) 182, 306, 375
BstMBI GATC 3 cut(s) 179, 303, 372
BstX2I RGATCY 1 cut(s) 372
BstYI RGATCY 1 cut(s) 372
BstZ17I GTATAC 1 cut(s) 138
Bsu15I ATCGAT 1 cut(s) 104
Bsu36I CCTNAGG 1 cut(s) 299
BsuRI GGCC 1 cut(s) 296
BsuTUI ATCGAT 1 cut(s) 104
CciI TCATGA 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 295
ClaI ATCGAT 1 cut(s) 104
Csp6I GTAC 3 cut(s) 33, 247, 478
CviAII CATG 1 cut(s) 80
CviJI RGCY 5 cut(s) 15, 74, 86, 296, 506
CviKI_1 RGCY 5 cut(s) 15, 74, 86, 296, 506
CviQI GTAC 3 cut(s) 33, 247, 478
DdeI CTNAG 1 cut(s) 299
DpnI GATC 3 cut(s) 181, 305, 374
DpnII GATC 3 cut(s) 179, 303, 372
Eam1104I CTCTTC 2 cut(s) 170, 306
EarI CTCTTC 2 cut(s) 170, 306
Eco81I CCTNAGG 1 cut(s) 299
Eco88I CYCGRG 1 cut(s) 324
EcoO109I RGGNCCY 1 cut(s) 295
EcoT22I ATGCAT 1 cut(s) 514
FaeI CATG 1 cut(s) 83
FatI CATG 1 cut(s) 79
FblI GTMKAC 1 cut(s) 137
HaeIII GGCC 1 cut(s) 296
Hin1II CATG 1 cut(s) 83
HinfI GANTC 3 cut(s) 229, 267, 404
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 2 cut(s) 138, 499
Hpy188I TCNGA 2 cut(s) 24, 184
Hpy188III TCNNGA 5 cut(s) 80, 233, 271, 301, 485
Hpy8I GTNNAC 2 cut(s) 138, 499
HpyAV CCTTC 4 cut(s) 4, 46, 109, 391
HpyCH4III ACNGT 1 cut(s) 482
HpyCH4IV ACGT 1 cut(s) 285
HpyCH4V TGCA 3 cut(s) 168, 368, 512
HpyF3I CTNAG 1 cut(s) 299
HpySE526I ACGT 1 cut(s) 285
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 3 cut(s) 179, 303, 372
LmnI GCTCC 1 cut(s) 487
LpnPI CCDG 5 cut(s) 141, 246, 286, 354, 464
MaeII ACGT 1 cut(s) 285
MaeIII GTNAC 1 cut(s) 346
MalI GATC 3 cut(s) 181, 305, 374
MboI GATC 3 cut(s) 179, 303, 372
MboII GAAGA 3 cut(s) 187, 197, 323
MflI RGATCY 1 cut(s) 372
MluCI AATT 4 cut(s) 25, 153, 435, 468
MnlI CCTC 2 cut(s) 308, 320
Mph1103I ATGCAT 1 cut(s) 514
MseI TTAA 3 cut(s) 333, 467, 519
Mva1269I GAATGC 1 cut(s) 430
NdeII GATC 3 cut(s) 179, 303, 372
NlaIII CATG 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 346
NsiI ATGCAT 1 cut(s) 514
PaeR7I CTCGAG 1 cut(s) 324
PagI TCATGA 1 cut(s) 79
PctI GAATGC 1 cut(s) 430
PfeI GAWTC 3 cut(s) 229, 267, 404
PspPI GGNCC 1 cut(s) 295
PspXI VCTCGAGB 1 cut(s) 324
PsuI RGATCY 1 cut(s) 372
RsaI GTAC 3 cut(s) 34, 248, 479
RsaNI GTAC 3 cut(s) 33, 247, 478
SaqAI TTAA 3 cut(s) 333, 467, 519
Sau3AI GATC 3 cut(s) 179, 303, 372
Sau96I GGNCC 1 cut(s) 295
SetI ASST 8 cut(s) 38, 130, 137, 245, 288, 388, 445, 539
Sfr274I CTCGAG 1 cut(s) 324
SlaI CTCGAG 1 cut(s) 324
SmlI CTYRAG 1 cut(s) 324
SmoI CTYRAG 1 cut(s) 324
Sse9I AATT 4 cut(s) 25, 153, 435, 468
SsiI CCGC 2 cut(s) 238, 342
TaaI ACNGT 1 cut(s) 482
TaiI ACGT 1 cut(s) 288
TaqI TCGA 2 cut(s) 104, 325
TasI AATT 4 cut(s) 25, 153, 435, 468
TatI WGTACW 1 cut(s) 246
TfiI GAWTC 3 cut(s) 229, 267, 404
Tru1I TTAA 3 cut(s) 333, 467, 519
Tru9I TTAA 3 cut(s) 333, 467, 519
TseFI GTSAC 1 cut(s) 346
Tsp45I GTSAC 1 cut(s) 346
TspDTI ATGAA 4 cut(s) 68, 96, 437, 542
XapI RAATTY 1 cut(s) 25
XhoI CTCGAG 1 cut(s) 324
XmiI GTMKAC 1 cut(s) 137
Zsp2I ATGCAT 1 cut(s) 514
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.